Incidental Mutation 'R6194:Fbxw2'
ID502766
Institutional Source Beutler Lab
Gene Symbol Fbxw2
Ensembl Gene ENSMUSG00000035949
Gene NameF-box and WD-40 domain protein 2
SynonymsMD6, FBW2, Fwd2
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location34804514-34826311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34807404 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 317 (T317I)
Ref Sequence ENSEMBL: ENSMUSP00000108703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028220] [ENSMUST00000091020] [ENSMUST00000113075] [ENSMUST00000113077] [ENSMUST00000113078] [ENSMUST00000113080]
Predicted Effect probably damaging
Transcript: ENSMUST00000028220
AA Change: T317I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028220
Gene: ENSMUSG00000035949
AA Change: T317I

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000091020
AA Change: T188I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088541
Gene: ENSMUSG00000035949
AA Change: T188I

DomainStartEndE-ValueType
WD40 8 45 4.48e-2 SMART
WD40 48 83 6.19e-1 SMART
WD40 86 125 4.44e-6 SMART
WD40 128 176 4.95e0 SMART
WD40 182 222 6.6e1 SMART
Blast:WD40 280 322 2e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113075
AA Change: T317I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108698
Gene: ENSMUSG00000035949
AA Change: T317I

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113077
AA Change: T252I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108700
Gene: ENSMUSG00000035949
AA Change: T252I

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 189 1.03e0 SMART
WD40 192 240 4.95e0 SMART
WD40 246 286 6.6e1 SMART
Blast:WD40 344 386 3e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113078
AA Change: T317I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108701
Gene: ENSMUSG00000035949
AA Change: T317I

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113080
AA Change: T317I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108703
Gene: ENSMUSG00000035949
AA Change: T317I

DomainStartEndE-ValueType
FBOX 60 100 4.19e-7 SMART
WD40 137 174 4.48e-2 SMART
WD40 177 212 6.19e-1 SMART
WD40 215 254 4.44e-6 SMART
WD40 257 305 4.95e0 SMART
WD40 311 351 6.6e1 SMART
Blast:WD40 409 451 6e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156130
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] F-box proteins are an expanding family of eukaryotic proteins characterized by an approximately 40 amino acid motif, the F box. Some F-box proteins have been shown to be critical for the ubiquitin-mediated degradation of cellular regulatory proteins. In fact, F-box proteins are one of the four subunits of ubiquitin protein ligases, called SCFs. SCF ligases bring ubiquitin conjugating enzymes to substrates that are specifically recruited by the different F-box proteins. Mammalian F-box proteins are classified into three groups based on the presence of either WD-40 repeats, leucine-rich repeats, or the presence or absence of other protein-protein interacting domains. This gene encodes the second identified member of the F-box gene family and contains multiple WD-40 repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Fbxw2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fbxw2 APN 2 34812949 missense probably benign 0.38
IGL00498:Fbxw2 APN 2 34805941 missense probably damaging 1.00
IGL01359:Fbxw2 APN 2 34822750 missense probably benign 0.07
IGL01770:Fbxw2 APN 2 34811026 missense possibly damaging 0.56
IGL01794:Fbxw2 APN 2 34811119 splice site probably benign
IGL01934:Fbxw2 APN 2 34822606 missense probably damaging 0.99
IGL02444:Fbxw2 APN 2 34805781 missense probably benign 0.09
IGL02948:Fbxw2 APN 2 34805711 makesense probably null
IGL03209:Fbxw2 APN 2 34822663 missense probably damaging 1.00
silkpurse UTSW 2 34812813 critical splice donor site probably null
R0597:Fbxw2 UTSW 2 34811020 missense probably damaging 0.99
R0636:Fbxw2 UTSW 2 34822847 nonsense probably null
R1489:Fbxw2 UTSW 2 34812817 small insertion probably benign
R1920:Fbxw2 UTSW 2 34822764 missense probably damaging 1.00
R3177:Fbxw2 UTSW 2 34822750 missense probably benign 0.07
R3277:Fbxw2 UTSW 2 34822750 missense probably benign 0.07
R6236:Fbxw2 UTSW 2 34822833 missense probably damaging 1.00
R6258:Fbxw2 UTSW 2 34812813 critical splice donor site probably null
R7382:Fbxw2 UTSW 2 34807302 missense probably benign 0.01
R7636:Fbxw2 UTSW 2 34812944 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCCTCCCATTACAACTTC -3'
(R):5'- AGGACTTAAGCCTGTGACTCTTG -3'

Sequencing Primer
(F):5'- CCATGTGTTGGGCATAAAACTTC -3'
(R):5'- GCCTGTGACTCTTGACTAAAACAG -3'
Posted On2018-02-27