Incidental Mutation 'R6194:5330417C22Rik'
ID502773
Institutional Source Beutler Lab
Gene Symbol 5330417C22Rik
Ensembl Gene ENSMUSG00000040412
Gene NameRIKEN cDNA 5330417C22 gene
Synonyms
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location108455694-108536536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108465779 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 600 (I600V)
Ref Sequence ENSEMBL: ENSMUSP00000102237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048012] [ENSMUST00000106625] [ENSMUST00000106626] [ENSMUST00000185128]
Predicted Effect probably benign
Transcript: ENSMUST00000048012
AA Change: I548V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040128
Gene: ENSMUSG00000040412
AA Change: I548V

DomainStartEndE-ValueType
internal_repeat_1 3 212 1.11e-6 PROSPERO
internal_repeat_1 289 522 1.11e-6 PROSPERO
transmembrane domain 806 828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106625
AA Change: I650V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102236
Gene: ENSMUSG00000040412
AA Change: I650V

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 310 8.31e-11 PROSPERO
internal_repeat_1 325 620 8.31e-11 PROSPERO
transmembrane domain 904 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106626
AA Change: I600V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102237
Gene: ENSMUSG00000040412
AA Change: I600V

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
internal_repeat_1 48 178 2.5e-7 PROSPERO
internal_repeat_1 275 421 2.5e-7 PROSPERO
transmembrane domain 854 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148493
Predicted Effect probably benign
Transcript: ENSMUST00000185128
SMART Domains Protein: ENSMUSP00000138870
Gene: ENSMUSG00000040412

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Expression of this gene is induced by estrogen and the encoded protein has been characterized as a transmembrane protein. The encoded protein has been found in to correlate with survival in certain carcinomas (PMID: 21102415) and may be important for cellular response to stress (PMID: 21072319). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Male homozygous mice are infertile. Microscopic analysis revealed defective spermatogenesis in the testis, and hypospermia and defective spermatozoa in the epididymides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in 5330417C22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:5330417C22Rik APN 3 108481312 missense possibly damaging 0.48
IGL02079:5330417C22Rik APN 3 108481359 missense possibly damaging 0.91
IGL02268:5330417C22Rik APN 3 108467797 missense probably benign 0.00
IGL02869:5330417C22Rik APN 3 108472866 missense probably benign 0.34
IGL02891:5330417C22Rik APN 3 108464392 missense probably benign 0.03
IGL03088:5330417C22Rik APN 3 108536358 missense probably damaging 1.00
IGL03345:5330417C22Rik APN 3 108492016 missense possibly damaging 0.68
IGL03398:5330417C22Rik APN 3 108461221 missense possibly damaging 0.94
IGL03138:5330417C22Rik UTSW 3 108471993 missense probably benign 0.08
R0325:5330417C22Rik UTSW 3 108461251 missense probably damaging 1.00
R0730:5330417C22Rik UTSW 3 108469535 missense probably benign 0.00
R0844:5330417C22Rik UTSW 3 108480963 splice site probably benign
R1646:5330417C22Rik UTSW 3 108462990 missense probably damaging 1.00
R1666:5330417C22Rik UTSW 3 108469997 missense probably benign 0.01
R1726:5330417C22Rik UTSW 3 108467868 missense possibly damaging 0.67
R2202:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2203:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2204:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2205:5330417C22Rik UTSW 3 108475043 missense probably damaging 1.00
R2249:5330417C22Rik UTSW 3 108471410 nonsense probably null
R2443:5330417C22Rik UTSW 3 108481349 missense probably damaging 1.00
R3965:5330417C22Rik UTSW 3 108458449 missense probably damaging 1.00
R4171:5330417C22Rik UTSW 3 108460943 missense probably benign 0.30
R4785:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R4810:5330417C22Rik UTSW 3 108470011 splice site probably benign
R4862:5330417C22Rik UTSW 3 108467833 missense probably benign
R4923:5330417C22Rik UTSW 3 108471968 critical splice donor site probably null
R5040:5330417C22Rik UTSW 3 108475001 missense probably damaging 1.00
R5153:5330417C22Rik UTSW 3 108472747 missense possibly damaging 0.75
R5405:5330417C22Rik UTSW 3 108467786 nonsense probably null
R5609:5330417C22Rik UTSW 3 108471415 missense probably damaging 0.96
R5663:5330417C22Rik UTSW 3 108492083 missense probably benign 0.00
R6303:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6304:5330417C22Rik UTSW 3 108461256 missense probably damaging 1.00
R6381:5330417C22Rik UTSW 3 108481814 missense possibly damaging 0.52
R6676:5330417C22Rik UTSW 3 108469915 missense probably damaging 1.00
R6852:5330417C22Rik UTSW 3 108482338 missense probably damaging 1.00
R7221:5330417C22Rik UTSW 3 108475001 missense possibly damaging 0.92
R7320:5330417C22Rik UTSW 3 108464303 nonsense probably null
R7384:5330417C22Rik UTSW 3 108463468 critical splice donor site probably null
R7542:5330417C22Rik UTSW 3 108458227 utr 3 prime probably benign
R7597:5330417C22Rik UTSW 3 108471429 missense possibly damaging 0.93
R7674:5330417C22Rik UTSW 3 108462991 missense probably damaging 1.00
R8076:5330417C22Rik UTSW 3 108492082 missense probably benign 0.11
X0022:5330417C22Rik UTSW 3 108459746 missense probably damaging 1.00
Z1176:5330417C22Rik UTSW 3 108471435 missense probably damaging 1.00
Z1176:5330417C22Rik UTSW 3 108471978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTACCTGGTTTCCACAGAG -3'
(R):5'- GCCACCACTTCAGACATGTTC -3'

Sequencing Primer
(F):5'- TTTCCACAGAGACTCAGGGTG -3'
(R):5'- TACTCCACTGCAGCTCTCA -3'
Posted On2018-02-27