Incidental Mutation 'R6194:Olfr275'
ID502775
Institutional Source Beutler Lab
Gene Symbol Olfr275
Ensembl Gene ENSMUSG00000089717
Gene Nameolfactory receptor 275
SynonymsGA_x6K02T2N78B-7168533-7167574, MOR262-2
MMRRC Submission 044334-MU
Accession Numbers

Ncbi RefSeq: NM_146858.2; MGI: 3030109

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location52814604-52828269 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 52825779 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 127 (C127*)
Ref Sequence ENSEMBL: ENSMUSP00000092700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095085]
Predicted Effect probably null
Transcript: ENSMUST00000095085
AA Change: C127*
SMART Domains Protein: ENSMUSP00000092700
Gene: ENSMUSG00000089717
AA Change: C127*

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 9.8e-54 PFAM
Pfam:7tm_1 41 290 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Olfr275
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Olfr275 APN 4 52825727 missense probably damaging 1.00
IGL01758:Olfr275 APN 4 52825468 nonsense probably null
IGL01925:Olfr275 APN 4 52825910 missense probably benign 0.00
IGL02525:Olfr275 APN 4 52825616 missense probably damaging 1.00
IGL02536:Olfr275 APN 4 52825817 missense possibly damaging 0.95
IGL02829:Olfr275 APN 4 52826027 missense probably damaging 0.98
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0190:Olfr275 UTSW 4 52825613 missense probably damaging 0.97
R4376:Olfr275 UTSW 4 52826195 missense possibly damaging 0.81
R4617:Olfr275 UTSW 4 52825399 start codon destroyed probably benign 0.35
R4658:Olfr275 UTSW 4 52826240 missense probably damaging 0.99
R4828:Olfr275 UTSW 4 52826138 missense probably damaging 1.00
R4850:Olfr275 UTSW 4 52825450 missense possibly damaging 0.94
R6401:Olfr275 UTSW 4 52826242 missense probably damaging 1.00
R6842:Olfr275 UTSW 4 52825576 missense probably damaging 1.00
R7033:Olfr275 UTSW 4 52826089 missense probably benign
R7998:Olfr275 UTSW 4 52825970 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCAACCTCTCATTTCTGGAC -3'
(R):5'- ACTGTACCATGGAAGTGTCTC -3'

Sequencing Primer
(F):5'- GGACATCTGGTATACCTCTTCTG -3'
(R):5'- TGTACCATGGAAGTGTCTCCACAG -3'
Posted On2018-02-27