Incidental Mutation 'R6194:Rbks'
ID502781
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Nameribokinase
Synonyms
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31624439-31697627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31666890 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 87 (E87G)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000201910]
Predicted Effect probably benign
Transcript: ENSMUST00000031018
AA Change: E87G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: E87G

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202690
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31660017 missense probably damaging 1.00
IGL02618:Rbks APN 5 31624519 nonsense probably null
IGL02678:Rbks APN 5 31673413 missense probably damaging 1.00
IGL02719:Rbks APN 5 31651801 intron probably benign
IGL02947:Rbks APN 5 31660063 missense probably benign
R0334:Rbks UTSW 5 31624519 nonsense probably null
R1441:Rbks UTSW 5 31659997 missense probably benign
R2568:Rbks UTSW 5 31665752 missense probably damaging 0.99
R4545:Rbks UTSW 5 31624568 missense probably benign 0.10
R4546:Rbks UTSW 5 31624568 missense probably benign 0.10
R4591:Rbks UTSW 5 31660008 missense possibly damaging 0.52
R4833:Rbks UTSW 5 31624515 missense probably benign 0.00
R4967:Rbks UTSW 5 31624532 missense probably damaging 1.00
R5076:Rbks UTSW 5 31650451 nonsense probably null
R5214:Rbks UTSW 5 31650392 intron probably benign
R6051:Rbks UTSW 5 31651819 missense probably damaging 1.00
R6607:Rbks UTSW 5 31647792 missense possibly damaging 0.92
R7246:Rbks UTSW 5 31647783 missense possibly damaging 0.58
Z1177:Rbks UTSW 5 31647863 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGGAGGAGCTACTAATTATACTTAG -3'
(R):5'- CCTTTGGCTGAAATATAGTCTAGC -3'

Sequencing Primer
(F):5'- ACTGCCTTGAGTTTGAGACCAGTAC -3'
(R):5'- GGCTGAAATATAGTCTAGCATCTTAC -3'
Posted On2018-02-27