Incidental Mutation 'R6194:Gusb'
ID502784
Institutional Source Beutler Lab
Gene Symbol Gusb
Ensembl Gene ENSMUSG00000025534
Gene Nameglucuronidase, beta
SynonymsGut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location129989011-130003049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129990065 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 577 (V577M)
Ref Sequence ENSEMBL: ENSMUSP00000026613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000201801] [ENSMUST00000201855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026613
AA Change: V577M

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: V577M

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 4e-46 PFAM
Pfam:Glyco_hydro_2 225 323 6.4e-12 PFAM
Pfam:Glyco_hydro_2_C 325 627 9e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126676
Predicted Effect probably benign
Transcript: ENSMUST00000201801
SMART Domains Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 138 5.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201855
SMART Domains Protein: ENSMUSP00000144608
Gene: ENSMUSG00000066735

DomainStartEndE-ValueType
Pfam:VKOR 17 88 5.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Gusb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gusb APN 5 129999381 missense probably damaging 1.00
IGL01561:Gusb APN 5 129998086 missense probably damaging 1.00
IGL02642:Gusb APN 5 130000535 intron probably null
IGL03307:Gusb APN 5 130000031 makesense probably null
R0389:Gusb UTSW 5 129998086 missense probably damaging 1.00
R1496:Gusb UTSW 5 129998544 missense probably benign 0.00
R1512:Gusb UTSW 5 130000890 missense probably damaging 1.00
R2125:Gusb UTSW 5 129999447 missense probably benign 0.00
R2888:Gusb UTSW 5 130000502 missense probably damaging 1.00
R2890:Gusb UTSW 5 130000502 missense probably damaging 1.00
R3017:Gusb UTSW 5 130000484 missense probably damaging 1.00
R4453:Gusb UTSW 5 129998483 missense possibly damaging 0.84
R4906:Gusb UTSW 5 129998118 missense probably damaging 0.98
R4937:Gusb UTSW 5 129995485 missense probably damaging 0.99
R5260:Gusb UTSW 5 129999988 nonsense probably null
R5281:Gusb UTSW 5 129998526 missense probably benign 0.00
R6248:Gusb UTSW 5 130000525 missense probably benign 0.01
R7121:Gusb UTSW 5 130000043 missense probably benign 0.44
R7209:Gusb UTSW 5 129998546 missense probably benign
R7768:Gusb UTSW 5 130000405 missense probably benign 0.01
Z1177:Gusb UTSW 5 130002736 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AACCCAATCTGAAGCCTACTTTTC -3'
(R):5'- AGTTAGTACAGCCCCGCATC -3'

Sequencing Primer
(F):5'- TCCTTTTAACCACTGTAAACTAGACC -3'
(R):5'- CCGCATCAGGACAGATCTTTTAGTG -3'
Posted On2018-02-27