Incidental Mutation 'R6194:Slx1b'
ID 502792
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene Name SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms 2410170E21Rik, 4833422P03Rik, Giyd2, 1110030E23Rik
MMRRC Submission 044334-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6194 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 126288640-126294956 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126291503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 187 (R187H)
Ref Sequence ENSEMBL: ENSMUSP00000118182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
AlphaFold Q8BX32
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144897
AA Change: R187H

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: R187H

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,309,033 (GRCm39) I90V probably benign Het
Afap1l2 T A 19: 56,911,383 (GRCm39) R370S probably damaging Het
Alcam A G 16: 52,088,761 (GRCm39) Y537H probably damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Asap1 A G 15: 64,001,058 (GRCm39) S508P probably damaging Het
Atg5 T C 10: 44,170,612 (GRCm39) L86P probably damaging Het
Atp13a5 G A 16: 29,127,057 (GRCm39) P502S probably damaging Het
AW209491 T A 13: 14,811,705 (GRCm39) I186K possibly damaging Het
Baz1b T C 5: 135,272,744 (GRCm39) Y1354H probably damaging Het
Card6 A T 15: 5,127,926 (GRCm39) S1157T unknown Het
Chil6 A G 3: 106,312,192 (GRCm39) probably null Het
Chrna1 A G 2: 73,400,816 (GRCm39) V238A probably benign Het
Cluap1 A G 16: 3,747,770 (GRCm39) S308G probably benign Het
Cntnap4 A G 8: 113,602,061 (GRCm39) D1155G probably damaging Het
Cptp A G 4: 155,951,098 (GRCm39) F123L probably damaging Het
Elapor1 T C 3: 108,373,095 (GRCm39) I600V probably benign Het
Fbxw2 G A 2: 34,697,416 (GRCm39) T317I probably damaging Het
Gc A T 5: 89,589,438 (GRCm39) V197E probably benign Het
Gusb C T 5: 130,018,906 (GRCm39) V577M possibly damaging Het
Hectd1 A T 12: 51,795,228 (GRCm39) N2400K probably damaging Het
Hnrnph1 T A 11: 50,274,104 (GRCm39) D340E possibly damaging Het
Hs3st1 C A 5: 39,771,748 (GRCm39) K298N probably damaging Het
Hunk A T 16: 90,293,283 (GRCm39) T522S probably damaging Het
Ifit3 T C 19: 34,565,027 (GRCm39) F191S probably benign Het
Ifnab T A 4: 88,609,362 (GRCm39) K35* probably null Het
Ifnab G T 4: 88,609,363 (GRCm39) N34K probably damaging Het
Ighmbp2 C A 19: 3,312,003 (GRCm39) R917L possibly damaging Het
Igkv13-84 C T 6: 68,916,916 (GRCm39) A71V possibly damaging Het
Irag1 T C 7: 110,498,901 (GRCm39) N377D probably damaging Het
Lim2 T A 7: 43,085,086 (GRCm39) C159S probably damaging Het
Lrrc56 T C 7: 140,785,564 (GRCm39) Y147H probably damaging Het
Ltn1 A G 16: 87,212,698 (GRCm39) L621P probably damaging Het
Mapk8ip1 C A 2: 92,219,589 (GRCm39) G81C probably damaging Het
Mboat2 T A 12: 24,996,637 (GRCm39) S213R probably benign Het
Mmel1 T A 4: 154,967,673 (GRCm39) C99* probably null Het
Myo9a A G 9: 59,777,033 (GRCm39) I1144V probably benign Het
Naa15 A G 3: 51,370,721 (GRCm39) T612A probably benign Het
Naalad2 C T 9: 18,262,443 (GRCm39) V362I probably benign Het
Nbeal1 A T 1: 60,296,643 (GRCm39) I1178F possibly damaging Het
Nras C A 3: 102,966,269 (GRCm39) A11E probably damaging Het
Or13f5 T A 4: 52,825,779 (GRCm39) C127* probably null Het
Or56a3b G T 7: 104,771,377 (GRCm39) V238L probably benign Het
Pcdhb7 A G 18: 37,475,199 (GRCm39) T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 (GRCm39) probably benign Het
Pfkfb2 A G 1: 130,625,624 (GRCm39) *519Q probably null Het
Prodh A T 16: 17,890,381 (GRCm39) H515Q probably benign Het
Rbfox2 T C 15: 76,968,357 (GRCm39) T435A possibly damaging Het
Rbks T C 5: 31,824,234 (GRCm39) E87G probably benign Het
Scyl1 G T 19: 5,820,334 (GRCm39) Q167K possibly damaging Het
Serpina3i T A 12: 104,232,762 (GRCm39) D222E probably benign Het
Slc36a4 T A 9: 15,638,172 (GRCm39) C199* probably null Het
Stxbp5 A G 10: 9,693,083 (GRCm39) F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tfpt A T 7: 3,632,026 (GRCm39) L28Q probably damaging Het
Trap1 G A 16: 3,872,664 (GRCm39) T335M possibly damaging Het
Zcchc2 T A 1: 105,918,847 (GRCm39) F110I probably damaging Het
Zfp345 A T 2: 150,314,551 (GRCm39) C329S probably damaging Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126,291,753 (GRCm39) missense probably benign 0.02
R0601:Slx1b UTSW 7 126,291,812 (GRCm39) missense probably damaging 1.00
R0714:Slx1b UTSW 7 126,291,620 (GRCm39) missense probably damaging 0.98
R1457:Slx1b UTSW 7 126,291,968 (GRCm39) missense probably damaging 0.98
R3975:Slx1b UTSW 7 126,290,979 (GRCm39) missense probably damaging 1.00
R4757:Slx1b UTSW 7 126,291,701 (GRCm39) missense probably benign
R4950:Slx1b UTSW 7 126,290,939 (GRCm39) utr 3 prime probably benign
R7334:Slx1b UTSW 7 126,291,699 (GRCm39) missense probably damaging 0.99
R9664:Slx1b UTSW 7 126,291,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGACTTCAGAAGGAGACC -3'
(R):5'- ACATGCTTCGAGTTCCTCCG -3'

Sequencing Primer
(F):5'- CCAGGGAAGATCTCACAGGATG -3'
(R):5'- TAACACTGCGTTGGCTGC -3'
Posted On 2018-02-27