Incidental Mutation 'R6194:Myo9a'
ID502797
Institutional Source Beutler Lab
Gene Symbol Myo9a
Ensembl Gene ENSMUSG00000039585
Gene Namemyosin IXa
SynonymsC130068I12Rik, 4732465J09Rik
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59750896-59928866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59869750 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1144 (I1144V)
Ref Sequence ENSEMBL: ENSMUSP00000122852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]
Predicted Effect probably benign
Transcript: ENSMUST00000128341
AA Change: I1144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: I1144V

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
Blast:MYSc 1685 1938 6e-89 BLAST
low complexity region 1982 1993 N/A INTRINSIC
C1 2002 2050 2.6e-9 SMART
RhoGAP 2075 2250 3.36e-73 SMART
coiled coil region 2320 2360 N/A INTRINSIC
low complexity region 2419 2438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135298
AA Change: I1144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: I1144V

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2391 2431 N/A INTRINSIC
low complexity region 2490 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136740
AA Change: I1144V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: I1144V

DomainStartEndE-ValueType
RA 14 112 5.57e-30 SMART
low complexity region 129 137 N/A INTRINSIC
MYSc 140 1018 N/A SMART
IQ 1019 1041 1.79e1 SMART
IQ 1042 1064 4.11e0 SMART
IQ 1074 1096 1.9e-2 SMART
IQ 1115 1137 1.01e-6 SMART
IQ 1138 1160 8.71e-2 SMART
low complexity region 1161 1173 N/A INTRINSIC
coiled coil region 1265 1285 N/A INTRINSIC
low complexity region 1372 1384 N/A INTRINSIC
coiled coil region 1492 1539 N/A INTRINSIC
low complexity region 1744 1759 N/A INTRINSIC
low complexity region 2053 2064 N/A INTRINSIC
C1 2073 2121 2.6e-9 SMART
RhoGAP 2146 2321 3.36e-73 SMART
coiled coil region 2409 2449 N/A INTRINSIC
low complexity region 2508 2527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Myo9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myo9a APN 9 59843059 splice site probably benign
IGL00510:Myo9a APN 9 59832181 splice site probably benign
IGL00710:Myo9a APN 9 59875311 missense probably damaging 1.00
IGL00963:Myo9a APN 9 59900372 missense probably damaging 0.98
IGL01087:Myo9a APN 9 59790078 missense possibly damaging 0.93
IGL01145:Myo9a APN 9 59855375 missense probably benign 0.18
IGL01403:Myo9a APN 9 59871563 missense probably damaging 0.98
IGL01528:Myo9a APN 9 59779674 missense probably damaging 1.00
IGL01608:Myo9a APN 9 59870836 nonsense probably null
IGL01701:Myo9a APN 9 59884594 critical splice donor site probably null
IGL01918:Myo9a APN 9 59779702 missense probably damaging 1.00
IGL02026:Myo9a APN 9 59905962 missense probably damaging 0.99
IGL02139:Myo9a APN 9 59779992 missense probably benign 0.07
IGL02176:Myo9a APN 9 59870553 missense probably benign 0.45
IGL02272:Myo9a APN 9 59884600 splice site probably benign
IGL02283:Myo9a APN 9 59871673 missense probably benign 0.00
IGL02499:Myo9a APN 9 59815386 splice site probably benign
IGL02652:Myo9a APN 9 59863928 missense probably damaging 1.00
IGL02666:Myo9a APN 9 59924904 missense probably benign 0.02
IGL02878:Myo9a APN 9 59908300 critical splice donor site probably null
IGL02982:Myo9a APN 9 59908208 nonsense probably null
IGL03072:Myo9a APN 9 59809442 missense possibly damaging 0.83
IGL03090:Myo9a APN 9 59894135 splice site probably benign
IGL03111:Myo9a APN 9 59827243 missense probably benign 0.19
IGL03389:Myo9a APN 9 59869607 missense probably damaging 1.00
essentials UTSW 9 59894866 missense probably benign 0.09
necessities UTSW 9 59815334 missense probably damaging 1.00
PIT4402001:Myo9a UTSW 9 59870436 missense possibly damaging 0.83
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0013:Myo9a UTSW 9 59860206 splice site probably benign
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0018:Myo9a UTSW 9 59871724 missense probably benign 0.00
R0329:Myo9a UTSW 9 59923677 missense probably damaging 1.00
R0423:Myo9a UTSW 9 59895336 missense probably damaging 1.00
R0521:Myo9a UTSW 9 59894352 missense probably damaging 1.00
R0607:Myo9a UTSW 9 59921793 missense probably benign 0.02
R0652:Myo9a UTSW 9 59871926 missense probably benign
R0653:Myo9a UTSW 9 59924991 missense probably damaging 1.00
R0723:Myo9a UTSW 9 59871100 missense probably benign 0.01
R0784:Myo9a UTSW 9 59896545 splice site probably benign
R0842:Myo9a UTSW 9 59871067 missense probably benign 0.02
R1055:Myo9a UTSW 9 59855370 missense probably benign 0.01
R1056:Myo9a UTSW 9 59832201 missense possibly damaging 0.64
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1195:Myo9a UTSW 9 59895200 missense probably damaging 1.00
R1615:Myo9a UTSW 9 59788456 missense possibly damaging 0.68
R1698:Myo9a UTSW 9 59868181 missense probably benign 0.05
R1715:Myo9a UTSW 9 59832300 missense probably damaging 0.99
R1981:Myo9a UTSW 9 59894146 missense probably benign
R2228:Myo9a UTSW 9 59894180 missense probably benign 0.06
R2272:Myo9a UTSW 9 59815301 missense probably damaging 1.00
R2327:Myo9a UTSW 9 59779765 missense probably benign 0.11
R2990:Myo9a UTSW 9 59924889 missense possibly damaging 0.95
R3161:Myo9a UTSW 9 59832315 splice site probably benign
R3721:Myo9a UTSW 9 59868180 missense probably benign
R3928:Myo9a UTSW 9 59895283 missense probably damaging 1.00
R4197:Myo9a UTSW 9 59894866 missense probably benign 0.09
R4212:Myo9a UTSW 9 59906066 nonsense probably null
R4610:Myo9a UTSW 9 59871882 missense probably benign
R4616:Myo9a UTSW 9 59821649 missense probably damaging 1.00
R4621:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4623:Myo9a UTSW 9 59871072 missense probably benign 0.00
R4632:Myo9a UTSW 9 59869664 missense probably benign 0.00
R4657:Myo9a UTSW 9 59875416 critical splice donor site probably null
R4892:Myo9a UTSW 9 59824242 missense probably damaging 0.98
R4897:Myo9a UTSW 9 59896517 missense probably benign 0.07
R4966:Myo9a UTSW 9 59871734 missense probably benign 0.00
R4993:Myo9a UTSW 9 59861472 nonsense probably null
R5160:Myo9a UTSW 9 59871802 missense probably benign 0.24
R5233:Myo9a UTSW 9 59910617 missense probably damaging 1.00
R5271:Myo9a UTSW 9 59907382 missense probably damaging 1.00
R5308:Myo9a UTSW 9 59863961 missense probably damaging 1.00
R5367:Myo9a UTSW 9 59900449 missense probably damaging 0.96
R5432:Myo9a UTSW 9 59865670 missense possibly damaging 0.94
R5459:Myo9a UTSW 9 59884520 missense probably damaging 0.98
R5511:Myo9a UTSW 9 59780212 missense probably damaging 1.00
R5568:Myo9a UTSW 9 59874628 missense probably benign
R5573:Myo9a UTSW 9 59871001 missense probably benign
R5589:Myo9a UTSW 9 59895244 nonsense probably null
R5607:Myo9a UTSW 9 59863944 missense probably damaging 1.00
R5633:Myo9a UTSW 9 59868184 missense possibly damaging 0.60
R5885:Myo9a UTSW 9 59871220 missense probably benign
R6024:Myo9a UTSW 9 59855388 missense possibly damaging 0.68
R6086:Myo9a UTSW 9 59790057 nonsense probably null
R6146:Myo9a UTSW 9 59871229 missense probably benign 0.01
R6213:Myo9a UTSW 9 59827258 missense probably damaging 1.00
R6368:Myo9a UTSW 9 59924948 missense probably benign 0.01
R6550:Myo9a UTSW 9 59868199 missense probably damaging 1.00
R6612:Myo9a UTSW 9 59827196 missense probably damaging 1.00
R6665:Myo9a UTSW 9 59871872 missense probably benign 0.09
R6951:Myo9a UTSW 9 59894768 missense probably damaging 1.00
R7026:Myo9a UTSW 9 59815334 missense probably damaging 1.00
R7107:Myo9a UTSW 9 59870815 missense probably benign 0.44
R7310:Myo9a UTSW 9 59871153 missense probably benign 0.08
R7473:Myo9a UTSW 9 59895244 missense probably benign 0.31
R7723:Myo9a UTSW 9 59779858 missense probably damaging 1.00
R7823:Myo9a UTSW 9 59811950 missense probably damaging 1.00
R7824:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R7965:Myo9a UTSW 9 59788438 missense probably damaging 1.00
R8031:Myo9a UTSW 9 59780091 missense probably benign 0.33
R8055:Myo9a UTSW 9 59907460 missense probably damaging 1.00
R8071:Myo9a UTSW 9 59874648 missense probably benign
R8250:Myo9a UTSW 9 59860109 missense probably damaging 1.00
R8260:Myo9a UTSW 9 59910678 missense probably benign 0.08
R8355:Myo9a UTSW 9 59909847 missense probably damaging 1.00
R8432:Myo9a UTSW 9 59780265 missense probably damaging 1.00
R8470:Myo9a UTSW 9 59832290 missense probably damaging 1.00
R8528:Myo9a UTSW 9 59860140 missense probably damaging 1.00
R8681:Myo9a UTSW 9 59868111 missense probably benign 0.16
R8690:Myo9a UTSW 9 59875374 missense probably benign
R8793:Myo9a UTSW 9 59884567 missense probably benign 0.03
R8812:Myo9a UTSW 9 59779747 missense probably benign 0.14
RF018:Myo9a UTSW 9 59869586 missense probably benign 0.00
RF019:Myo9a UTSW 9 59921772 missense probably benign 0.00
Z1176:Myo9a UTSW 9 59895259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCATAATGGCTAGTGCAG -3'
(R):5'- TGCACAGACAATACAGGTTGGAAC -3'

Sequencing Primer
(F):5'- AGTGCAGCTTCCCTTCTTCAGG -3'
(R):5'- CAGACAATACAGGTTGGAACTAGTAG -3'
Posted On2018-02-27