Mutagenetix > Incidental Mutations

Incidental Mutation 'R6194:Myo9a'

502797

Institutional Source

Beutler Lab

Gene Symbol

Myo9a

Ensembl Gene

ENSMUSG00000039585

Gene Name

myosin IXa

Synonyms

C130068I12Rik, 4732465J09Rik

MMRRC Submission

044334-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6194 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59750896-59928866 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59869750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1144 (I1144V)

Ref Sequence

ENSEMBL: ENSMUSP00000122852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000128341] [ENSMUST00000135298] [ENSMUST00000136740]

AlphaFold

Q8C170

Predicted Effect

probably benign
Transcript: ENSMUST00000128341
AA Change: I1144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119401
Gene: ENSMUSG00000039585
AA Change: I1144V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
Blast:MYSc	1685	1938	6e-89	BLAST
low complexity region	1982	1993	N/A	INTRINSIC
C1	2002	2050	2.6e-9	SMART
RhoGAP	2075	2250	3.36e-73	SMART
coiled coil region	2320	2360	N/A	INTRINSIC
low complexity region	2419	2438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135298
AA Change: I1144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117432
Gene: ENSMUSG00000039585
AA Change: I1144V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2391	2431	N/A	INTRINSIC
low complexity region	2490	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136740
AA Change: I1144V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000122852
Gene: ENSMUSG00000039585
AA Change: I1144V

Domain	Start	End	E-Value	Type
RA	14	112	5.57e-30	SMART
low complexity region	129	137	N/A	INTRINSIC
MYSc	140	1018	N/A	SMART
IQ	1019	1041	1.79e1	SMART
IQ	1042	1064	4.11e0	SMART
IQ	1074	1096	1.9e-2	SMART
IQ	1115	1137	1.01e-6	SMART
IQ	1138	1160	8.71e-2	SMART
low complexity region	1161	1173	N/A	INTRINSIC
coiled coil region	1265	1285	N/A	INTRINSIC
low complexity region	1372	1384	N/A	INTRINSIC
coiled coil region	1492	1539	N/A	INTRINSIC
low complexity region	1744	1759	N/A	INTRINSIC
low complexity region	2053	2064	N/A	INTRINSIC
C1	2073	2121	2.6e-9	SMART
RhoGAP	2146	2321	3.36e-73	SMART
coiled coil region	2409	2449	N/A	INTRINSIC
low complexity region	2508	2527	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147364

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215963

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with Bardet-Biedl Syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous KO leads to obstructive hydrocephaly caused by blockage of the third ventricle and the rostral aqueduct caused by developmental failures of their ependymal cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031410I06Rik	T	C	5: 26,104,035	I90V	probably benign	Het
5330417C22Rik	T	C	3: 108,465,779	I600V	probably benign	Het
Afap1l2	T	A	19: 56,922,951	R370S	probably damaging	Het
Alcam	A	G	16: 52,268,398	Y537H	probably damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Asap1	A	G	15: 64,129,209	S508P	probably damaging	Het
Atg5	T	C	10: 44,294,616	L86P	probably damaging	Het
Atp13a5	G	A	16: 29,308,239	P502S	probably damaging	Het
AW209491	T	A	13: 14,637,120	I186K	possibly damaging	Het
Baz1b	T	C	5: 135,243,890	Y1354H	probably damaging	Het
Card6	A	T	15: 5,098,444	S1157T	unknown	Het
Chil6	A	G	3: 106,404,876		probably null	Het
Chrna1	A	G	2: 73,570,472	V238A	probably benign	Het
Cluap1	A	G	16: 3,929,906	S308G	probably benign	Het
Cntnap4	A	G	8: 112,875,429	D1155G	probably damaging	Het
Cptp	A	G	4: 155,866,641	F123L	probably damaging	Het
Fbxw2	G	A	2: 34,807,404	T317I	probably damaging	Het
Gc	A	T	5: 89,441,579	V197E	probably benign	Het
Gusb	C	T	5: 129,990,065	V577M	possibly damaging	Het
Hectd1	A	T	12: 51,748,445	N2400K	probably damaging	Het
Hnrnph1	T	A	11: 50,383,277	D340E	possibly damaging	Het
Hs3st1	C	A	5: 39,614,405	K298N	probably damaging	Het
Hunk	A	T	16: 90,496,395	T522S	probably damaging	Het
Ifit3	T	C	19: 34,587,627	F191S	probably benign	Het
Ifnab	T	A	4: 88,691,125	K35*	probably null	Het
Ifnab	G	T	4: 88,691,126	N34K	probably damaging	Het
Ighmbp2	C	A	19: 3,262,003	R917L	possibly damaging	Het
Igkv13-84	C	T	6: 68,939,932	A71V	possibly damaging	Het
Lim2	T	A	7: 43,435,662	C159S	probably damaging	Het
Lrrc56	T	C	7: 141,205,651	Y147H	probably damaging	Het
Ltn1	A	G	16: 87,415,810	L621P	probably damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Mboat2	T	A	12: 24,946,638	S213R	probably benign	Het
Mmel1	T	A	4: 154,883,216	C99*	probably null	Het
Mrvi1	T	C	7: 110,899,694	N377D	probably damaging	Het
Naa15	A	G	3: 51,463,300	T612A	probably benign	Het
Naalad2	C	T	9: 18,351,147	V362I	probably benign	Het
Nbeal1	A	T	1: 60,257,484	I1178F	possibly damaging	Het
Nras	C	A	3: 103,058,953	A11E	probably damaging	Het
Olfr275	T	A	4: 52,825,779	C127*	probably null	Het
Olfr681	G	T	7: 105,122,170	V238L	probably benign	Het
Pcdhb7	A	G	18: 37,342,146	T112A	probably damaging	Het
Peg10	C	CCCATCAGGA	6: 4,756,351		probably benign	Het
Pfkfb2	A	G	1: 130,697,887	*519Q	probably null	Het
Prodh	A	T	16: 18,072,517	H515Q	probably benign	Het
Rbfox2	T	C	15: 77,084,157	T435A	possibly damaging	Het
Rbks	T	C	5: 31,666,890	E87G	probably benign	Het
Scyl1	G	T	19: 5,770,306	Q167K	possibly damaging	Het
Serpina3i	T	A	12: 104,266,503	D222E	probably benign	Het
Slc36a4	T	A	9: 15,726,876	C199*	probably null	Het
Slx1b	C	T	7: 126,692,331	R187H	possibly damaging	Het
Stxbp5	A	G	10: 9,817,339	F348L	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tfpt	A	T	7: 3,629,027	L28Q	probably damaging	Het
Trap1	G	A	16: 4,054,800	T335M	possibly damaging	Het
Zcchc2	T	A	1: 105,991,117	F110I	probably damaging	Het
Zfp345	A	T	2: 150,472,631	C329S	probably damaging	Het

Other mutations in Myo9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Myo9a	APN	9	59843059	splice site	probably benign
IGL00510:Myo9a	APN	9	59832181	splice site	probably benign
IGL00710:Myo9a	APN	9	59875311	missense	probably damaging	1.00
IGL00963:Myo9a	APN	9	59900372	missense	probably damaging	0.98
IGL01087:Myo9a	APN	9	59790078	missense	possibly damaging	0.93
IGL01145:Myo9a	APN	9	59855375	missense	probably benign	0.18
IGL01403:Myo9a	APN	9	59871563	missense	probably damaging	0.98
IGL01528:Myo9a	APN	9	59779674	missense	probably damaging	1.00
IGL01608:Myo9a	APN	9	59870836	nonsense	probably null
IGL01701:Myo9a	APN	9	59884594	critical splice donor site	probably null
IGL01918:Myo9a	APN	9	59779702	missense	probably damaging	1.00
IGL02026:Myo9a	APN	9	59905962	missense	probably damaging	0.99
IGL02139:Myo9a	APN	9	59779992	missense	probably benign	0.07
IGL02176:Myo9a	APN	9	59870553	missense	probably benign	0.45
IGL02272:Myo9a	APN	9	59884600	splice site	probably benign
IGL02283:Myo9a	APN	9	59871673	missense	probably benign	0.00
IGL02499:Myo9a	APN	9	59815386	splice site	probably benign
IGL02652:Myo9a	APN	9	59863928	missense	probably damaging	1.00
IGL02666:Myo9a	APN	9	59924904	missense	probably benign	0.02
IGL02878:Myo9a	APN	9	59908300	critical splice donor site	probably null
IGL02982:Myo9a	APN	9	59908208	nonsense	probably null
IGL03072:Myo9a	APN	9	59809442	missense	possibly damaging	0.83
IGL03090:Myo9a	APN	9	59894135	splice site	probably benign
IGL03111:Myo9a	APN	9	59827243	missense	probably benign	0.19
IGL03389:Myo9a	APN	9	59869607	missense	probably damaging	1.00
essentials	UTSW	9	59894866	missense	probably benign	0.09
necessities	UTSW	9	59815334	missense	probably damaging	1.00
PIT4402001:Myo9a	UTSW	9	59870436	missense	possibly damaging	0.83
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0013:Myo9a	UTSW	9	59860206	splice site	probably benign
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0018:Myo9a	UTSW	9	59871724	missense	probably benign	0.00
R0329:Myo9a	UTSW	9	59923677	missense	probably damaging	1.00
R0423:Myo9a	UTSW	9	59895336	missense	probably damaging	1.00
R0521:Myo9a	UTSW	9	59894352	missense	probably damaging	1.00
R0607:Myo9a	UTSW	9	59921793	missense	probably benign	0.02
R0652:Myo9a	UTSW	9	59871926	missense	probably benign
R0653:Myo9a	UTSW	9	59924991	missense	probably damaging	1.00
R0723:Myo9a	UTSW	9	59871100	missense	probably benign	0.01
R0784:Myo9a	UTSW	9	59896545	splice site	probably benign
R0842:Myo9a	UTSW	9	59871067	missense	probably benign	0.02
R1055:Myo9a	UTSW	9	59855370	missense	probably benign	0.01
R1056:Myo9a	UTSW	9	59832201	missense	possibly damaging	0.64
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1195:Myo9a	UTSW	9	59895200	missense	probably damaging	1.00
R1615:Myo9a	UTSW	9	59788456	missense	possibly damaging	0.68
R1698:Myo9a	UTSW	9	59868181	missense	probably benign	0.05
R1715:Myo9a	UTSW	9	59832300	missense	probably damaging	0.99
R1981:Myo9a	UTSW	9	59894146	missense	probably benign
R2228:Myo9a	UTSW	9	59894180	missense	probably benign	0.06
R2272:Myo9a	UTSW	9	59815301	missense	probably damaging	1.00
R2327:Myo9a	UTSW	9	59779765	missense	probably benign	0.11
R2990:Myo9a	UTSW	9	59924889	missense	possibly damaging	0.95
R3161:Myo9a	UTSW	9	59832315	splice site	probably benign
R3721:Myo9a	UTSW	9	59868180	missense	probably benign
R3928:Myo9a	UTSW	9	59895283	missense	probably damaging	1.00
R4197:Myo9a	UTSW	9	59894866	missense	probably benign	0.09
R4212:Myo9a	UTSW	9	59906066	nonsense	probably null
R4610:Myo9a	UTSW	9	59871882	missense	probably benign
R4616:Myo9a	UTSW	9	59821649	missense	probably damaging	1.00
R4621:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4623:Myo9a	UTSW	9	59871072	missense	probably benign	0.00
R4632:Myo9a	UTSW	9	59869664	missense	probably benign	0.00
R4657:Myo9a	UTSW	9	59875416	critical splice donor site	probably null
R4892:Myo9a	UTSW	9	59824242	missense	probably damaging	0.98
R4897:Myo9a	UTSW	9	59896517	missense	probably benign	0.07
R4966:Myo9a	UTSW	9	59871734	missense	probably benign	0.00
R4993:Myo9a	UTSW	9	59861472	nonsense	probably null
R5160:Myo9a	UTSW	9	59871802	missense	probably benign	0.24
R5233:Myo9a	UTSW	9	59910617	missense	probably damaging	1.00
R5271:Myo9a	UTSW	9	59907382	missense	probably damaging	1.00
R5308:Myo9a	UTSW	9	59863961	missense	probably damaging	1.00
R5367:Myo9a	UTSW	9	59900449	missense	probably damaging	0.96
R5432:Myo9a	UTSW	9	59865670	missense	possibly damaging	0.94
R5459:Myo9a	UTSW	9	59884520	missense	probably damaging	0.98
R5511:Myo9a	UTSW	9	59780212	missense	probably damaging	1.00
R5568:Myo9a	UTSW	9	59874628	missense	probably benign
R5573:Myo9a	UTSW	9	59871001	missense	probably benign
R5589:Myo9a	UTSW	9	59895244	nonsense	probably null
R5607:Myo9a	UTSW	9	59863944	missense	probably damaging	1.00
R5633:Myo9a	UTSW	9	59868184	missense	possibly damaging	0.60
R5885:Myo9a	UTSW	9	59871220	missense	probably benign
R6024:Myo9a	UTSW	9	59855388	missense	possibly damaging	0.68
R6086:Myo9a	UTSW	9	59790057	nonsense	probably null
R6146:Myo9a	UTSW	9	59871229	missense	probably benign	0.01
R6213:Myo9a	UTSW	9	59827258	missense	probably damaging	1.00
R6368:Myo9a	UTSW	9	59924948	missense	probably benign	0.01
R6550:Myo9a	UTSW	9	59868199	missense	probably damaging	1.00
R6612:Myo9a	UTSW	9	59827196	missense	probably damaging	1.00
R6665:Myo9a	UTSW	9	59871872	missense	probably benign	0.09
R6951:Myo9a	UTSW	9	59894768	missense	probably damaging	1.00
R7026:Myo9a	UTSW	9	59815334	missense	probably damaging	1.00
R7107:Myo9a	UTSW	9	59870815	missense	probably benign	0.44
R7310:Myo9a	UTSW	9	59871153	missense	probably benign	0.08
R7473:Myo9a	UTSW	9	59895244	missense	probably benign	0.31
R7723:Myo9a	UTSW	9	59779858	missense	probably damaging	1.00
R7823:Myo9a	UTSW	9	59811950	missense	probably damaging	1.00
R7824:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R7965:Myo9a	UTSW	9	59788438	missense	probably damaging	1.00
R8031:Myo9a	UTSW	9	59780091	missense	probably benign	0.33
R8055:Myo9a	UTSW	9	59907460	missense	probably damaging	1.00
R8071:Myo9a	UTSW	9	59874648	missense	probably benign
R8250:Myo9a	UTSW	9	59860109	missense	probably damaging	1.00
R8260:Myo9a	UTSW	9	59910678	missense	probably benign	0.08
R8355:Myo9a	UTSW	9	59909847	missense	probably damaging	1.00
R8432:Myo9a	UTSW	9	59780265	missense	probably damaging	1.00
R8470:Myo9a	UTSW	9	59832290	missense	probably damaging	1.00
R8528:Myo9a	UTSW	9	59860140	missense	probably damaging	1.00
R8681:Myo9a	UTSW	9	59868111	missense	probably benign	0.16
R8690:Myo9a	UTSW	9	59875374	missense	probably benign
R8793:Myo9a	UTSW	9	59884567	missense	probably benign	0.03
R8812:Myo9a	UTSW	9	59779747	missense	probably benign	0.14
R9016:Myo9a	UTSW	9	59868144	nonsense	probably null
R9026:Myo9a	UTSW	9	59809474	missense	probably damaging	0.96
R9036:Myo9a	UTSW	9	59780301	nonsense	probably null
R9130:Myo9a	UTSW	9	59832231	missense	probably damaging	0.98
R9131:Myo9a	UTSW	9	59861489	missense	probably damaging	1.00
R9213:Myo9a	UTSW	9	59865639	missense	probably benign	0.04
RF018:Myo9a	UTSW	9	59869586	missense	probably benign	0.00
RF019:Myo9a	UTSW	9	59921772	missense	probably benign	0.00
Z1176:Myo9a	UTSW	9	59895259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTCATAATGGCTAGTGCAG -3'
(R):5'- TGCACAGACAATACAGGTTGGAAC -3'

Sequencing Primer
(F):5'- AGTGCAGCTTCCCTTCTTCAGG -3'
(R):5'- CAGACAATACAGGTTGGAACTAGTAG -3'

Posted On

2018-02-27