Mutagenetix > Incidental Mutations

Incidental Mutation 'R6194:Hectd1'

502802

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

044334-MU

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6194 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51748445 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2400 (N2400K)

Ref Sequence

ENSEMBL: ENSMUSP00000136449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042052
AA Change: N2395K

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: N2395K

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179265
AA Change: N2400K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: N2400K

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218820

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031410I06Rik	T	C	5: 26,104,035	I90V	probably benign	Het
5330417C22Rik	T	C	3: 108,465,779	I600V	probably benign	Het
Afap1l2	T	A	19: 56,922,951	R370S	probably damaging	Het
Alcam	A	G	16: 52,268,398	Y537H	probably damaging	Het
Araf	G	T	X: 20,860,100	R601L	probably damaging	Homo
Asap1	A	G	15: 64,129,209	S508P	probably damaging	Het
Atg5	T	C	10: 44,294,616	L86P	probably damaging	Het
Atp13a5	G	A	16: 29,308,239	P502S	probably damaging	Het
AW209491	T	A	13: 14,637,120	I186K	possibly damaging	Het
Baz1b	T	C	5: 135,243,890	Y1354H	probably damaging	Het
Card6	A	T	15: 5,098,444	S1157T	unknown	Het
Chil6	A	G	3: 106,404,876		probably null	Het
Chrna1	A	G	2: 73,570,472	V238A	probably benign	Het
Cluap1	A	G	16: 3,929,906	S308G	probably benign	Het
Cntnap4	A	G	8: 112,875,429	D1155G	probably damaging	Het
Cptp	A	G	4: 155,866,641	F123L	probably damaging	Het
Fbxw2	G	A	2: 34,807,404	T317I	probably damaging	Het
Gc	A	T	5: 89,441,579	V197E	probably benign	Het
Gusb	C	T	5: 129,990,065	V577M	possibly damaging	Het
Hnrnph1	T	A	11: 50,383,277	D340E	possibly damaging	Het
Hs3st1	C	A	5: 39,614,405	K298N	probably damaging	Het
Hunk	A	T	16: 90,496,395	T522S	probably damaging	Het
Ifit3	T	C	19: 34,587,627	F191S	probably benign	Het
Ifnab	T	A	4: 88,691,125	K35*	probably null	Het
Ifnab	G	T	4: 88,691,126	N34K	probably damaging	Het
Ighmbp2	C	A	19: 3,262,003	R917L	possibly damaging	Het
Igkv13-84	C	T	6: 68,939,932	A71V	possibly damaging	Het
Lim2	T	A	7: 43,435,662	C159S	probably damaging	Het
Lrrc56	T	C	7: 141,205,651	Y147H	probably damaging	Het
Ltn1	A	G	16: 87,415,810	L621P	probably damaging	Het
Mapk8ip1	C	A	2: 92,389,244	G81C	probably damaging	Het
Mboat2	T	A	12: 24,946,638	S213R	probably benign	Het
Mmel1	T	A	4: 154,883,216	C99*	probably null	Het
Mrvi1	T	C	7: 110,899,694	N377D	probably damaging	Het
Myo9a	A	G	9: 59,869,750	I1144V	probably benign	Het
Naa15	A	G	3: 51,463,300	T612A	probably benign	Het
Naalad2	C	T	9: 18,351,147	V362I	probably benign	Het
Nbeal1	A	T	1: 60,257,484	I1178F	possibly damaging	Het
Nras	C	A	3: 103,058,953	A11E	probably damaging	Het
Olfr275	T	A	4: 52,825,779	C127*	probably null	Het
Olfr681	G	T	7: 105,122,170	V238L	probably benign	Het
Pcdhb7	A	G	18: 37,342,146	T112A	probably damaging	Het
Peg10	C	CCCATCAGGA	6: 4,756,351		probably benign	Het
Pfkfb2	A	G	1: 130,697,887	*519Q	probably null	Het
Prodh	A	T	16: 18,072,517	H515Q	probably benign	Het
Rbfox2	T	C	15: 77,084,157	T435A	possibly damaging	Het
Rbks	T	C	5: 31,666,890	E87G	probably benign	Het
Scyl1	G	T	19: 5,770,306	Q167K	possibly damaging	Het
Serpina3i	T	A	12: 104,266,503	D222E	probably benign	Het
Slc36a4	T	A	9: 15,726,876	C199*	probably null	Het
Slx1b	C	T	7: 126,692,331	R187H	possibly damaging	Het
Stxbp5	A	G	10: 9,817,339	F348L	probably damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tfpt	A	T	7: 3,629,027	L28Q	probably damaging	Het
Trap1	G	A	16: 4,054,800	T335M	possibly damaging	Het
Zcchc2	T	A	1: 105,991,117	F110I	probably damaging	Het
Zfp345	A	T	2: 150,472,631	C329S	probably damaging	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1350:Hectd1	UTSW	12	51762434	missense	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2061:Hectd1	UTSW	12	51794444	missense	probably damaging	0.99
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5062:Hectd1	UTSW	12	51744879	missense	probably damaging	0.98
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5535:Hectd1	UTSW	12	51802326	missense	probably damaging	0.98
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7346:Hectd1	UTSW	12	51750321	missense	probably benign
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	synonymous	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7925:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R8059:Hectd1	UTSW	12	51790378	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- CTGTAGCATTTATTGGCTGATAGAG -3'
(R):5'- CCAGCCTGGTTTAATGGGATTTTAAC -3'

Sequencing Primer
(F):5'- GCAATGTCTTATGTATCCCAAGCTGG -3'
(R):5'- GTTTAATGGGATTTTAACTTGGGAAG -3'

Posted On

2018-02-27