Incidental Mutation 'R6194:Asap1'
ID502806
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
MMRRC Submission 044334-MU
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64129209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 508 (S508P)
Ref Sequence ENSEMBL: ENSMUSP00000134825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect probably damaging
Transcript: ENSMUST00000023008
AA Change: S508P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110114
AA Change: S508P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110115
AA Change: S493P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377
AA Change: S493P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175793
AA Change: S496P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377
AA Change: S496P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175799
AA Change: S505P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377
AA Change: S505P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176014
AA Change: S505P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377
AA Change: S505P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176384
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177035
AA Change: S493P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377
AA Change: S493P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177083
AA Change: S473P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377
AA Change: S473P

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177371
AA Change: S485P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377
AA Change: S485P

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177374
AA Change: S508P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377
AA Change: S508P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5493:Asap1 UTSW 15 64130151 missense possibly damaging 0.85
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R5790:Asap1 UTSW 15 64094265 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7218:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7305:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7310:Asap1 UTSW 15 64099530 critical splice donor site probably null
R7439:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7441:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7488:Asap1 UTSW 15 64120125 missense probably benign 0.29
R7597:Asap1 UTSW 15 64312455 missense probably benign 0.37
R7708:Asap1 UTSW 15 64152872 missense probably damaging 1.00
R7871:Asap1 UTSW 15 64092076 missense probably damaging 1.00
R7954:Asap1 UTSW 15 64092076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTACCTGTTCAGGCAAATCC -3'
(R):5'- GTGGTAAAGGGATCCTAGCC -3'

Sequencing Primer
(F):5'- GTTCAGGCAAATCCGTTAAAATTTAC -3'
(R):5'- CCCTAGAACTGATTGTTAGCAAGG -3'
Posted On2018-02-27