Incidental Mutation 'R6194:Alcam'
ID502812
Institutional Source Beutler Lab
Gene Symbol Alcam
Ensembl Gene ENSMUSG00000022636
Gene Nameactivated leukocyte cell adhesion molecule
SynonymsSC1, BEN, MuSC, DM-GRASP, CD166
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location52248996-52454074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52268398 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 537 (Y537H)
Ref Sequence ENSEMBL: ENSMUSP00000129714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023312] [ENSMUST00000164728] [ENSMUST00000170035]
Predicted Effect probably damaging
Transcript: ENSMUST00000023312
AA Change: Y550H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023312
Gene: ENSMUSG00000022636
AA Change: Y550H

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 5.1e-24 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 489 3.8e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163788
Predicted Effect probably damaging
Transcript: ENSMUST00000164728
AA Change: Y550H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127141
Gene: ENSMUSG00000022636
AA Change: Y550H

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 1e-22 PFAM
Pfam:Ig_2 147 235 3.8e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 496 1.9e-7 PFAM
Pfam:Ig_2 415 502 1.5e-6 PFAM
transmembrane domain 528 550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164888
Predicted Effect unknown
Transcript: ENSMUST00000167115
AA Change: Y311H
SMART Domains Protein: ENSMUSP00000130563
Gene: ENSMUSG00000022636
AA Change: Y311H

DomainStartEndE-ValueType
Pfam:C2-set_2 1 80 3.6e-21 PFAM
IG 101 175 6.26e-5 SMART
Pfam:Ig_3 177 251 1.7e-6 PFAM
transmembrane domain 290 312 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170035
AA Change: Y537H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129714
Gene: ENSMUSG00000022636
AA Change: Y537H

DomainStartEndE-ValueType
IG 26 131 8.46e-2 SMART
Pfam:C2-set_2 137 231 3.4e-23 PFAM
Pfam:Ig_2 147 235 1.3e-2 PFAM
IG 255 330 6.35e-6 SMART
IG 339 413 6.26e-5 SMART
Pfam:Ig_3 415 491 5.9e-8 PFAM
Pfam:Ig_2 415 502 4.9e-7 PFAM
transmembrane domain 515 537 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes activated leukocyte cell adhesion molecule (ALCAM), also known as CD166 (cluster of differentiation 166), which is a member of a subfamily of immunoglobulin receptors with five immunoglobulin-like domains (VVC2C2C2) in the extracellular domain. This protein binds to T-cell differentiation antigene CD6, and is implicated in the processes of cell adhesion and migration. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display abnormal motor neuron and retinal ganglion cell morphology and retinal dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Scyl1 G T 19: 5,770,306 Q167K possibly damaging Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Alcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Alcam APN 16 52295017 splice site probably benign
IGL00737:Alcam APN 16 52253180 missense unknown
IGL01514:Alcam APN 16 52274290 splice site probably benign
IGL01837:Alcam APN 16 52253168 missense probably benign 0.10
IGL02143:Alcam APN 16 52305619 missense probably damaging 0.99
IGL02231:Alcam APN 16 52274050 splice site probably benign
IGL02375:Alcam APN 16 52288936 missense probably benign 0.00
IGL02579:Alcam APN 16 52270772 missense probably damaging 1.00
IGL02678:Alcam APN 16 52274038 missense probably damaging 1.00
IGL02798:Alcam APN 16 52305639 missense probably damaging 1.00
IGL02974:Alcam APN 16 52295716 missense probably benign 0.05
IGL03335:Alcam APN 16 52291003 nonsense probably null
PIT4402001:Alcam UTSW 16 52295134 missense probably damaging 1.00
PIT4651001:Alcam UTSW 16 52295187 missense probably benign
R0282:Alcam UTSW 16 52295741 missense probably damaging 0.99
R0395:Alcam UTSW 16 52309864 missense probably benign 0.42
R0760:Alcam UTSW 16 52295672 missense probably benign 0.32
R0882:Alcam UTSW 16 52253210 missense possibly damaging 0.47
R1433:Alcam UTSW 16 52295752 critical splice acceptor site probably null
R1677:Alcam UTSW 16 52270773 missense probably damaging 1.00
R1751:Alcam UTSW 16 52270714 missense probably damaging 1.00
R1767:Alcam UTSW 16 52270714 missense probably damaging 1.00
R2440:Alcam UTSW 16 52305613 missense probably damaging 1.00
R2963:Alcam UTSW 16 52295041 missense probably benign 0.00
R3410:Alcam UTSW 16 52309898 missense probably null 0.03
R4327:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4328:Alcam UTSW 16 52253216 missense possibly damaging 0.62
R4888:Alcam UTSW 16 52268813 missense probably benign 0.03
R5088:Alcam UTSW 16 52288927 missense probably damaging 1.00
R5202:Alcam UTSW 16 52274236 missense probably damaging 1.00
R5208:Alcam UTSW 16 52295048 nonsense probably null
R5278:Alcam UTSW 16 52274275 missense probably benign
R5799:Alcam UTSW 16 52309849 missense probably benign 0.28
R5909:Alcam UTSW 16 52290993 missense probably benign
R5960:Alcam UTSW 16 52295126 missense probably benign 0.30
R6434:Alcam UTSW 16 52288827 intron probably null
R6831:Alcam UTSW 16 52309901 missense probably benign 0.00
R6868:Alcam UTSW 16 52268385 missense probably damaging 1.00
R6930:Alcam UTSW 16 52305655 missense probably benign 0.14
R6957:Alcam UTSW 16 52276894 missense probably damaging 1.00
R7109:Alcam UTSW 16 52276829 missense probably damaging 0.98
R7473:Alcam UTSW 16 52452519 unclassified probably benign
R7562:Alcam UTSW 16 52268823 missense probably benign 0.00
R7568:Alcam UTSW 16 52268386 missense probably damaging 1.00
R7631:Alcam UTSW 16 52288913 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGCCACATTCTTGACGTTGG -3'
(R):5'- ACAGTAGTGATCTCTTAGCCATC -3'

Sequencing Primer
(F):5'- GGTCCCGTCCTCACTATGAAG -3'
(R):5'- GTAGTGATCTCTTAGCCATCATTAAC -3'
Posted On2018-02-27