Incidental Mutation 'R6194:Scyl1'
ID502817
Institutional Source Beutler Lab
Gene Symbol Scyl1
Ensembl Gene ENSMUSG00000024941
Gene NameSCY1-like 1 (S. cerevisiae)
Synonyms2810011O19Rik, mfd, mdf, Ntkl, p105
MMRRC Submission 044334-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R6194 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5758427-5771401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5770306 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 167 (Q167K)
Ref Sequence ENSEMBL: ENSMUSP00000025890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025890
AA Change: Q167K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941
AA Change: Q167K

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation or a knock-out allele develop a motoneuron disease characterized by gait ataxia, reduced grip strength, tremors, progressive hindlimb paralysis, muscular atrophy, and motoneuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031410I06Rik T C 5: 26,104,035 I90V probably benign Het
5330417C22Rik T C 3: 108,465,779 I600V probably benign Het
Afap1l2 T A 19: 56,922,951 R370S probably damaging Het
Alcam A G 16: 52,268,398 Y537H probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Asap1 A G 15: 64,129,209 S508P probably damaging Het
Atg5 T C 10: 44,294,616 L86P probably damaging Het
Atp13a5 G A 16: 29,308,239 P502S probably damaging Het
AW209491 T A 13: 14,637,120 I186K possibly damaging Het
Baz1b T C 5: 135,243,890 Y1354H probably damaging Het
Card6 A T 15: 5,098,444 S1157T unknown Het
Chil6 A G 3: 106,404,876 probably null Het
Chrna1 A G 2: 73,570,472 V238A probably benign Het
Cluap1 A G 16: 3,929,906 S308G probably benign Het
Cntnap4 A G 8: 112,875,429 D1155G probably damaging Het
Cptp A G 4: 155,866,641 F123L probably damaging Het
Fbxw2 G A 2: 34,807,404 T317I probably damaging Het
Gc A T 5: 89,441,579 V197E probably benign Het
Gusb C T 5: 129,990,065 V577M possibly damaging Het
Hectd1 A T 12: 51,748,445 N2400K probably damaging Het
Hnrnph1 T A 11: 50,383,277 D340E possibly damaging Het
Hs3st1 C A 5: 39,614,405 K298N probably damaging Het
Hunk A T 16: 90,496,395 T522S probably damaging Het
Ifit3 T C 19: 34,587,627 F191S probably benign Het
Ifnab T A 4: 88,691,125 K35* probably null Het
Ifnab G T 4: 88,691,126 N34K probably damaging Het
Ighmbp2 C A 19: 3,262,003 R917L possibly damaging Het
Igkv13-84 C T 6: 68,939,932 A71V possibly damaging Het
Lim2 T A 7: 43,435,662 C159S probably damaging Het
Lrrc56 T C 7: 141,205,651 Y147H probably damaging Het
Ltn1 A G 16: 87,415,810 L621P probably damaging Het
Mapk8ip1 C A 2: 92,389,244 G81C probably damaging Het
Mboat2 T A 12: 24,946,638 S213R probably benign Het
Mmel1 T A 4: 154,883,216 C99* probably null Het
Mrvi1 T C 7: 110,899,694 N377D probably damaging Het
Myo9a A G 9: 59,869,750 I1144V probably benign Het
Naa15 A G 3: 51,463,300 T612A probably benign Het
Naalad2 C T 9: 18,351,147 V362I probably benign Het
Nbeal1 A T 1: 60,257,484 I1178F possibly damaging Het
Nras C A 3: 103,058,953 A11E probably damaging Het
Olfr275 T A 4: 52,825,779 C127* probably null Het
Olfr681 G T 7: 105,122,170 V238L probably benign Het
Pcdhb7 A G 18: 37,342,146 T112A probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Pfkfb2 A G 1: 130,697,887 *519Q probably null Het
Prodh A T 16: 18,072,517 H515Q probably benign Het
Rbfox2 T C 15: 77,084,157 T435A possibly damaging Het
Rbks T C 5: 31,666,890 E87G probably benign Het
Serpina3i T A 12: 104,266,503 D222E probably benign Het
Slc36a4 T A 9: 15,726,876 C199* probably null Het
Slx1b C T 7: 126,692,331 R187H possibly damaging Het
Stxbp5 A G 10: 9,817,339 F348L probably damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tfpt A T 7: 3,629,027 L28Q probably damaging Het
Trap1 G A 16: 4,054,800 T335M possibly damaging Het
Zcchc2 T A 1: 105,991,117 F110I probably damaging Het
Zfp345 A T 2: 150,472,631 C329S probably damaging Het
Other mutations in Scyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Scyl1 APN 19 5766196 missense probably damaging 1.00
IGL02488:Scyl1 APN 19 5770313 nonsense probably null
IGL02816:Scyl1 APN 19 5770382 missense probably damaging 0.99
spartacus UTSW 19 5760826 missense probably damaging 1.00
R1957:Scyl1 UTSW 19 5760104 missense probably benign 0.00
R2267:Scyl1 UTSW 19 5761721 missense possibly damaging 0.78
R4598:Scyl1 UTSW 19 5770453 missense probably damaging 1.00
R5034:Scyl1 UTSW 19 5759994 missense probably benign 0.01
R5203:Scyl1 UTSW 19 5771367 start gained probably benign
R6159:Scyl1 UTSW 19 5764757 missense probably benign 0.03
R6360:Scyl1 UTSW 19 5760571 missense probably damaging 1.00
R6625:Scyl1 UTSW 19 5760826 missense probably damaging 1.00
R7214:Scyl1 UTSW 19 5760029 missense probably benign
R8046:Scyl1 UTSW 19 5760592 missense possibly damaging 0.70
R8068:Scyl1 UTSW 19 5760825 missense probably damaging 1.00
Z1177:Scyl1 UTSW 19 5758851 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTTCAAATCCAGAAGCACCG -3'
(R):5'- ATACCTCAAGGCACGAGCAG -3'

Sequencing Primer
(F):5'- TTTCCCAGCGGGTCTAGG -3'
(R):5'- AGCAGAAGCAGGTGGCC -3'
Posted On2018-02-27