Incidental Mutation 'R6195:Scn1a'
ID 502828
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Name sodium channel, voltage-gated, type I, alpha
Synonyms Nav1.1
MMRRC Submission 044335-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6195 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66101125-66271181 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66107962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1588 (Y1588F)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
AlphaFold A2APX8
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: Y1588F

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: Y1588F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094951
AA Change: Y1571F

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: Y1571F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112366
AA Change: Y1599F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: Y1599F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: Y1588F

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: Y1588F

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156865
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200839
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 192,857,142 (GRCm39) probably null Het
Aadacl2fm2 G A 3: 59,659,623 (GRCm39) V359I probably damaging Het
Abtb1 T C 6: 88,817,718 (GRCm39) E50G probably benign Het
Agbl2 T A 2: 90,643,657 (GRCm39) D792E probably benign Het
Aoc1 C A 6: 48,885,611 (GRCm39) N705K probably damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef7 C T 8: 11,872,017 (GRCm39) T701I probably damaging Het
Atg10 G T 13: 91,356,555 (GRCm39) probably null Het
Atp5f1c T C 2: 10,068,926 (GRCm39) I116M possibly damaging Het
Baz2b T A 2: 59,737,855 (GRCm39) Q1818L possibly damaging Het
Bod1 A G 11: 31,616,740 (GRCm39) *174Q probably null Het
Cacna1a A G 8: 85,315,382 (GRCm39) Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 (GRCm39) D260G probably benign Het
Cyp1b1 G T 17: 80,021,695 (GRCm39) L16M probably damaging Het
Dhx29 T A 13: 113,101,071 (GRCm39) S1205T probably benign Het
Dlec1 A G 9: 118,966,321 (GRCm39) K1097E probably benign Het
Dnah7b G A 1: 46,243,429 (GRCm39) D1578N probably damaging Het
Dok3 T C 13: 55,671,389 (GRCm39) N394S probably benign Het
Dpcd A G 19: 45,565,458 (GRCm39) D144G probably damaging Het
Efhb A G 17: 53,769,580 (GRCm39) F243S possibly damaging Het
Eif2ak2 A T 17: 79,178,662 (GRCm39) Y137* probably null Het
Eif4e1b A G 13: 54,932,018 (GRCm39) N34S probably null Het
F2rl3 A G 8: 73,489,513 (GRCm39) T247A probably benign Het
Fan1 A T 7: 64,004,119 (GRCm39) H782Q probably damaging Het
Fer1l5 T C 1: 36,414,367 (GRCm39) probably null Het
Fer1l6 T C 15: 58,509,806 (GRCm39) S1423P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fgfbp1 T C 5: 44,136,704 (GRCm39) D196G possibly damaging Het
Fxn G A 19: 24,239,407 (GRCm39) R162C probably damaging Het
Fxr2 C T 11: 69,543,099 (GRCm39) T632M probably benign Het
Gab1 A T 8: 81,606,161 (GRCm39) Y24* probably null Het
Gcc2 T C 10: 58,106,806 (GRCm39) S681P probably damaging Het
Git2 T C 5: 114,905,175 (GRCm39) N94S probably benign Het
Gm5799 T G 14: 43,782,088 (GRCm39) L87V probably damaging Het
Golga7b A T 19: 42,251,886 (GRCm39) D44V probably benign Het
Hace1 T A 10: 45,546,539 (GRCm39) I391N possibly damaging Het
Hmcn2 T C 2: 31,274,127 (GRCm39) S1416P probably damaging Het
Hoxa11 G A 6: 52,222,681 (GRCm39) R7C probably damaging Het
Igkv14-126 A T 6: 67,873,475 (GRCm39) T68S possibly damaging Het
Insyn2a T C 7: 134,520,377 (GRCm39) D51G probably damaging Het
Itpr3 T C 17: 27,305,934 (GRCm39) I164T probably damaging Het
Kif22 A G 7: 126,628,131 (GRCm39) S540P probably damaging Het
Ldlr T A 9: 21,643,077 (GRCm39) C34* probably null Het
Lrrtm4 T C 6: 79,998,939 (GRCm39) L117P probably damaging Het
Mad2l1 G T 6: 66,514,612 (GRCm39) G94C possibly damaging Het
Malrd1 C A 2: 15,700,137 (GRCm39) H661Q probably damaging Het
Mical3 T A 6: 120,993,796 (GRCm39) probably benign Het
Mipep T A 14: 61,109,554 (GRCm39) W644R probably damaging Het
Mycl A G 4: 122,893,713 (GRCm39) D171G probably damaging Het
Myof A G 19: 37,901,805 (GRCm39) F997L possibly damaging Het
Nagpa C T 16: 5,021,613 (GRCm39) R46H probably damaging Het
Nf1 A G 11: 79,456,801 (GRCm39) Y629C probably damaging Het
Obscn T A 11: 58,888,033 (GRCm39) E2164V probably damaging Het
Or52h1 A T 7: 103,828,961 (GRCm39) V218D possibly damaging Het
Or5ac23 A G 16: 59,149,785 (GRCm39) V29A possibly damaging Het
Or5w19 T C 2: 87,698,904 (GRCm39) S190P possibly damaging Het
Or8k25 T C 2: 86,243,551 (GRCm39) I282V probably damaging Het
Pcdh20 T C 14: 88,705,488 (GRCm39) E604G probably benign Het
Pcdhb7 G A 18: 37,475,709 (GRCm39) V282I probably benign Het
Pcnx4 A G 12: 72,603,648 (GRCm39) D523G possibly damaging Het
Pigx G A 16: 31,903,404 (GRCm39) T219I probably damaging Het
Plch1 G T 3: 63,648,210 (GRCm39) P399Q probably damaging Het
Pvrig-ps T A 5: 138,340,537 (GRCm39) F74I possibly damaging Het
Rsrp1 T A 4: 134,654,113 (GRCm39) I255K probably damaging Het
Serpina9 T A 12: 103,967,666 (GRCm39) H243L probably damaging Het
Tapbp T C 17: 34,138,956 (GRCm39) L41P probably damaging Het
Tbc1d16 T A 11: 119,101,391 (GRCm39) K40* probably null Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tbc1d23 T C 16: 57,051,713 (GRCm39) E6G possibly damaging Het
Tdrd6 A G 17: 43,940,643 (GRCm39) V135A probably damaging Het
Tmem87a A T 2: 120,222,656 (GRCm39) probably null Het
Tnrc18 T A 5: 142,750,928 (GRCm39) K1217N unknown Het
Trim33 G A 3: 103,244,848 (GRCm39) probably null Het
Ttn T A 2: 76,567,997 (GRCm39) Y27632F probably benign Het
Tubgcp6 A T 15: 89,006,994 (GRCm39) D9E probably benign Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Zfp655 T A 5: 145,180,572 (GRCm39) F143L possibly damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66,165,875 (GRCm39) critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66,111,137 (GRCm39) missense probably damaging 1.00
IGL00658:Scn1a APN 2 66,116,382 (GRCm39) missense probably damaging 1.00
IGL00823:Scn1a APN 2 66,155,279 (GRCm39) missense probably benign 0.04
IGL00907:Scn1a APN 2 66,158,141 (GRCm39) missense probably damaging 1.00
IGL01339:Scn1a APN 2 66,156,304 (GRCm39) missense probably benign 0.09
IGL01401:Scn1a APN 2 66,119,455 (GRCm39) missense probably damaging 1.00
IGL01503:Scn1a APN 2 66,152,687 (GRCm39) missense probably damaging 1.00
IGL01575:Scn1a APN 2 66,103,580 (GRCm39) missense probably damaging 1.00
IGL01598:Scn1a APN 2 66,132,829 (GRCm39) missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66,116,281 (GRCm39) missense probably damaging 1.00
IGL01796:Scn1a APN 2 66,162,645 (GRCm39) splice site probably benign
IGL02079:Scn1a APN 2 66,153,704 (GRCm39) missense probably benign 0.14
IGL02171:Scn1a APN 2 66,103,543 (GRCm39) missense probably damaging 1.00
IGL02335:Scn1a APN 2 66,108,005 (GRCm39) missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66,156,380 (GRCm39) missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66,181,497 (GRCm39) missense probably benign 0.01
IGL02507:Scn1a APN 2 66,108,157 (GRCm39) missense probably damaging 1.00
IGL02646:Scn1a APN 2 66,129,962 (GRCm39) splice site probably null
IGL02729:Scn1a APN 2 66,129,994 (GRCm39) missense probably damaging 1.00
IGL02740:Scn1a APN 2 66,148,421 (GRCm39) missense probably benign 0.00
IGL02740:Scn1a APN 2 66,155,106 (GRCm39) missense probably damaging 1.00
IGL02752:Scn1a APN 2 66,161,756 (GRCm39) missense probably damaging 1.00
IGL02815:Scn1a APN 2 66,155,202 (GRCm39) missense probably damaging 1.00
IGL03163:Scn1a APN 2 66,148,418 (GRCm39) missense probably benign 0.00
IGL03229:Scn1a APN 2 66,130,057 (GRCm39) missense probably damaging 1.00
IGL03286:Scn1a APN 2 66,107,920 (GRCm39) missense probably damaging 0.99
IGL03393:Scn1a APN 2 66,148,362 (GRCm39) missense probably benign 0.19
BB008:Scn1a UTSW 2 66,148,156 (GRCm39) missense probably damaging 0.99
BB018:Scn1a UTSW 2 66,148,156 (GRCm39) missense probably damaging 0.99
PIT4791001:Scn1a UTSW 2 66,103,626 (GRCm39) missense probably benign 0.18
R0053:Scn1a UTSW 2 66,130,119 (GRCm39) missense probably benign 0.05
R0053:Scn1a UTSW 2 66,130,119 (GRCm39) missense probably benign 0.05
R0107:Scn1a UTSW 2 66,154,977 (GRCm39) missense probably benign 0.07
R0141:Scn1a UTSW 2 66,119,406 (GRCm39) missense probably damaging 1.00
R0485:Scn1a UTSW 2 66,104,269 (GRCm39) missense probably damaging 0.98
R0517:Scn1a UTSW 2 66,132,751 (GRCm39) missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66,148,167 (GRCm39) missense probably damaging 1.00
R0746:Scn1a UTSW 2 66,181,470 (GRCm39) missense probably benign 0.25
R0755:Scn1a UTSW 2 66,151,379 (GRCm39) missense probably damaging 1.00
R0830:Scn1a UTSW 2 66,130,128 (GRCm39) missense probably damaging 1.00
R0846:Scn1a UTSW 2 66,155,099 (GRCm39) missense probably benign 0.43
R0918:Scn1a UTSW 2 66,153,651 (GRCm39) splice site probably null
R1055:Scn1a UTSW 2 66,168,340 (GRCm39) missense probably benign 0.08
R1432:Scn1a UTSW 2 66,152,773 (GRCm39) missense probably damaging 1.00
R1497:Scn1a UTSW 2 66,162,631 (GRCm39) missense probably damaging 1.00
R1512:Scn1a UTSW 2 66,161,629 (GRCm39) missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66,149,806 (GRCm39) nonsense probably null
R1567:Scn1a UTSW 2 66,103,675 (GRCm39) missense probably damaging 1.00
R1702:Scn1a UTSW 2 66,148,567 (GRCm39) missense probably damaging 1.00
R1744:Scn1a UTSW 2 66,152,620 (GRCm39) missense probably benign 0.06
R1834:Scn1a UTSW 2 66,154,961 (GRCm39) missense probably benign 0.00
R1834:Scn1a UTSW 2 66,154,960 (GRCm39) missense probably benign 0.04
R1860:Scn1a UTSW 2 66,148,326 (GRCm39) missense probably damaging 0.99
R1871:Scn1a UTSW 2 66,148,369 (GRCm39) missense probably damaging 0.98
R1909:Scn1a UTSW 2 66,161,696 (GRCm39) missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66,158,769 (GRCm39) missense probably damaging 1.00
R1976:Scn1a UTSW 2 66,161,615 (GRCm39) missense probably benign 0.02
R2291:Scn1a UTSW 2 66,119,312 (GRCm39) missense probably benign 0.44
R2302:Scn1a UTSW 2 66,108,089 (GRCm39) missense probably damaging 1.00
R2367:Scn1a UTSW 2 66,158,023 (GRCm39) missense probably damaging 1.00
R2418:Scn1a UTSW 2 66,104,187 (GRCm39) missense probably damaging 0.98
R2517:Scn1a UTSW 2 66,104,176 (GRCm39) missense probably damaging 1.00
R2568:Scn1a UTSW 2 66,103,813 (GRCm39) missense probably damaging 1.00
R3083:Scn1a UTSW 2 66,129,981 (GRCm39) missense probably damaging 1.00
R3903:Scn1a UTSW 2 66,148,476 (GRCm39) missense probably benign 0.08
R3909:Scn1a UTSW 2 66,104,332 (GRCm39) missense probably damaging 1.00
R3916:Scn1a UTSW 2 66,107,957 (GRCm39) missense probably damaging 1.00
R3935:Scn1a UTSW 2 66,158,120 (GRCm39) missense probably damaging 0.99
R3936:Scn1a UTSW 2 66,158,120 (GRCm39) missense probably damaging 0.99
R4043:Scn1a UTSW 2 66,156,380 (GRCm39) missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66,181,329 (GRCm39) missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66,111,146 (GRCm39) critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66,181,332 (GRCm39) missense probably benign 0.23
R4834:Scn1a UTSW 2 66,158,866 (GRCm39) nonsense probably null
R4873:Scn1a UTSW 2 66,158,820 (GRCm39) missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66,158,820 (GRCm39) missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66,108,145 (GRCm39) missense probably damaging 1.00
R5255:Scn1a UTSW 2 66,108,013 (GRCm39) missense probably damaging 0.99
R5435:Scn1a UTSW 2 66,103,878 (GRCm39) missense probably damaging 1.00
R5449:Scn1a UTSW 2 66,151,346 (GRCm39) missense probably damaging 0.96
R5519:Scn1a UTSW 2 66,162,557 (GRCm39) missense probably damaging 1.00
R5541:Scn1a UTSW 2 66,154,977 (GRCm39) missense probably benign 0.07
R5556:Scn1a UTSW 2 66,155,141 (GRCm39) missense probably benign 0.00
R5587:Scn1a UTSW 2 66,103,425 (GRCm39) missense probably benign 0.01
R5972:Scn1a UTSW 2 66,181,454 (GRCm39) missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66,165,800 (GRCm39) missense probably damaging 1.00
R6233:Scn1a UTSW 2 66,107,962 (GRCm39) missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66,103,660 (GRCm39) missense probably damaging 1.00
R6417:Scn1a UTSW 2 66,103,542 (GRCm39) missense probably damaging 1.00
R6420:Scn1a UTSW 2 66,103,542 (GRCm39) missense probably damaging 1.00
R6421:Scn1a UTSW 2 66,103,271 (GRCm39) missense probably damaging 1.00
R6461:Scn1a UTSW 2 66,156,466 (GRCm39) missense probably null 0.01
R6701:Scn1a UTSW 2 66,168,304 (GRCm39) missense probably damaging 0.99
R6717:Scn1a UTSW 2 66,162,631 (GRCm39) missense probably damaging 1.00
R6834:Scn1a UTSW 2 66,158,086 (GRCm39) missense probably damaging 1.00
R6918:Scn1a UTSW 2 66,162,557 (GRCm39) missense probably damaging 1.00
R6953:Scn1a UTSW 2 66,149,813 (GRCm39) missense probably damaging 1.00
R6996:Scn1a UTSW 2 66,118,075 (GRCm39) missense probably damaging 1.00
R7022:Scn1a UTSW 2 66,148,243 (GRCm39) missense probably damaging 1.00
R7109:Scn1a UTSW 2 66,181,286 (GRCm39) missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66,154,962 (GRCm39) nonsense probably null
R7239:Scn1a UTSW 2 66,108,000 (GRCm39) splice site probably null
R7434:Scn1a UTSW 2 66,103,389 (GRCm39) missense probably benign
R7646:Scn1a UTSW 2 66,118,102 (GRCm39) missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66,134,004 (GRCm39) missense probably benign
R7879:Scn1a UTSW 2 66,116,349 (GRCm39) nonsense probably null
R7931:Scn1a UTSW 2 66,148,156 (GRCm39) missense probably damaging 0.99
R7962:Scn1a UTSW 2 66,158,786 (GRCm39) missense probably damaging 1.00
R8025:Scn1a UTSW 2 66,148,557 (GRCm39) missense probably benign 0.02
R8055:Scn1a UTSW 2 66,149,845 (GRCm39) missense probably damaging 1.00
R8095:Scn1a UTSW 2 66,132,809 (GRCm39) missense possibly damaging 0.93
R8167:Scn1a UTSW 2 66,155,182 (GRCm39) missense probably damaging 0.98
R8339:Scn1a UTSW 2 66,116,373 (GRCm39) missense probably damaging 1.00
R8363:Scn1a UTSW 2 66,152,601 (GRCm39) missense probably damaging 1.00
R8516:Scn1a UTSW 2 66,156,478 (GRCm39) missense possibly damaging 0.79
R8559:Scn1a UTSW 2 66,118,077 (GRCm39) missense probably damaging 1.00
R8726:Scn1a UTSW 2 66,133,983 (GRCm39) missense probably benign
R8733:Scn1a UTSW 2 66,154,944 (GRCm39) missense probably benign
R8779:Scn1a UTSW 2 66,181,257 (GRCm39) critical splice donor site probably benign
R8841:Scn1a UTSW 2 66,156,466 (GRCm39) missense probably benign 0.09
R8916:Scn1a UTSW 2 66,108,127 (GRCm39) missense probably damaging 1.00
R8919:Scn1a UTSW 2 66,168,330 (GRCm39) missense probably benign 0.16
R9040:Scn1a UTSW 2 66,148,245 (GRCm39) missense probably damaging 0.99
R9086:Scn1a UTSW 2 66,181,358 (GRCm39) missense probably benign 0.01
R9176:Scn1a UTSW 2 66,103,689 (GRCm39) missense probably damaging 1.00
R9228:Scn1a UTSW 2 66,130,099 (GRCm39) missense probably benign 0.10
R9275:Scn1a UTSW 2 66,130,026 (GRCm39) missense probably damaging 1.00
R9365:Scn1a UTSW 2 66,148,465 (GRCm39) missense probably benign 0.10
R9478:Scn1a UTSW 2 66,156,493 (GRCm39) missense probably benign 0.01
R9560:Scn1a UTSW 2 66,158,131 (GRCm39) missense probably damaging 1.00
R9608:Scn1a UTSW 2 66,152,687 (GRCm39) missense probably benign 0.02
R9624:Scn1a UTSW 2 66,153,766 (GRCm39) missense probably benign
Z1176:Scn1a UTSW 2 66,156,472 (GRCm39) missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66,155,296 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCGTATAGAGTGTTTAATCTCAACCAC -3'
(R):5'- GTGTTTGATATCAGCATCATGATCC -3'

Sequencing Primer
(F):5'- GTGTTTAATCTCAACCACCTAAAAGC -3'
(R):5'- ATGATCCTCATCTGTCTGAACATGG -3'
Posted On 2018-02-27