Incidental Mutation 'R6195:Creb3'
ID 502837
Institutional Source Beutler Lab
Gene Symbol Creb3
Ensembl Gene ENSMUSG00000028466
Gene Name cAMP responsive element binding protein 3
Synonyms LZIP, LZIP-1, Luman, LZIP-2
MMRRC Submission 044335-MU
Accession Numbers

NCBI RefSeq: NM_013497.3; MGI: 99946

Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock # R6195 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43562332-43567060 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43566346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 260 (D260G)
Ref Sequence ENSEMBL: ENSMUSP00000100008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030187
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030189
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
AA Change: D260G

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466
AA Change: D260G

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130670
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect probably benign
Transcript: ENSMUST00000167751
AA Change: D284G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466
AA Change: D284G

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Creb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Creb3 APN 4 43565517 missense probably benign
IGL02641:Creb3 APN 4 43563311 missense probably benign 0.00
IGL03101:Creb3 APN 4 43563081 missense probably benign 0.11
IGL03163:Creb3 APN 4 43566315 missense probably damaging 1.00
P0014:Creb3 UTSW 4 43563265 missense possibly damaging 0.53
PIT4362001:Creb3 UTSW 4 43565472 nonsense probably null
R0959:Creb3 UTSW 4 43563509 missense probably damaging 1.00
R1506:Creb3 UTSW 4 43566193 missense possibly damaging 0.95
R1624:Creb3 UTSW 4 43566375 missense possibly damaging 0.67
R1693:Creb3 UTSW 4 43566755 missense probably damaging 1.00
R1794:Creb3 UTSW 4 43563302 missense probably benign 0.06
R1956:Creb3 UTSW 4 43563279 critical splice acceptor site probably null
R1991:Creb3 UTSW 4 43565327 missense probably damaging 1.00
R2179:Creb3 UTSW 4 43566306 missense probably damaging 1.00
R3811:Creb3 UTSW 4 43565501 nonsense probably null
R4673:Creb3 UTSW 4 43563192 missense probably benign 0.20
R4713:Creb3 UTSW 4 43563247 missense probably benign 0.00
R5613:Creb3 UTSW 4 43566196 missense probably benign 0.41
R7673:Creb3 UTSW 4 43563117 missense not run
R7829:Creb3 UTSW 4 43566322 missense probably damaging 1.00
R7872:Creb3 UTSW 4 43563332 missense probably benign 0.04
R8726:Creb3 UTSW 4 43566747 missense probably benign 0.31
R9477:Creb3 UTSW 4 43566298 missense probably damaging 1.00
R9673:Creb3 UTSW 4 43563191 missense probably damaging 0.97
R9706:Creb3 UTSW 4 43565520 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCTTCTAGATCAACTGAGGAAG -3'
(R):5'- TTCGGCTGATGATCGTCCTC -3'

Sequencing Primer
(F):5'- CTTCAAGCCATGGTGATTGAGATAGC -3'
(R):5'- CTGATGATCGTCCTCGCTGG -3'
Posted On 2018-02-27