Incidental Mutation 'R6195:Mycl'
ID502839
Institutional Source Beutler Lab
Gene Symbol Mycl
Ensembl Gene ENSMUSG00000028654
Gene Namev-myc avian myelocytomatosis viral oncogene lung carcinoma derived
SynonymsLmyc-1, Lmyc1, bHLHe38, L-myc, Mycl1
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6195 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location122995652-123002485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122999920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000101859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030407] [ENSMUST00000106252] [ENSMUST00000144998]
Predicted Effect probably damaging
Transcript: ENSMUST00000030407
AA Change: D171G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030407
Gene: ENSMUSG00000028654
AA Change: D171G

DomainStartEndE-ValueType
Pfam:Myc_N 1 161 6.7e-29 PFAM
Pfam:Myc_N 137 230 1.1e-11 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106252
AA Change: D171G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101859
Gene: ENSMUSG00000028654
AA Change: D171G

DomainStartEndE-ValueType
Pfam:Myc_N 1 157 3.4e-31 PFAM
Pfam:Myc_N 116 231 1e-9 PFAM
HLH 291 343 6.07e-14 SMART
low complexity region 348 361 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135925
Predicted Effect probably benign
Transcript: ENSMUST00000144998
SMART Domains Protein: ENSMUSP00000117232
Gene: ENSMUSG00000028654

DomainStartEndE-ValueType
Pfam:Myc_N 1 58 7.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147259
Meta Mutation Damage Score 0.5685 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix leucine zipper (bHLHZip) protein that heterodimerizes with another bHLHZip protein to drive transcription of targets important for proliferation, apoptosis and differentiation. Mice lacking this gene product show marked decrease in T-cell priming during bacterial and viral infections. In humans, this gene was found to be amplified in small-cell lung cancers. Alternate splicing of this gene results in multiple variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null allele are viable, fertile and apparently healthy with no congenital defects or gross morphological/cellular alterations of the CNS, lung, kidney and GI tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Tnrc18 T A 5: 142,765,173 K1217N unknown Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Mycl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Mycl APN 4 122996977 missense probably damaging 1.00
IGL02678:Mycl APN 4 122999983 missense probably damaging 1.00
R1509:Mycl UTSW 4 123000307 missense probably damaging 1.00
R2348:Mycl UTSW 4 122996952 missense probably benign 0.07
R4050:Mycl UTSW 4 122996839 unclassified probably null
R4209:Mycl UTSW 4 122999922 missense possibly damaging 0.57
R4798:Mycl UTSW 4 123000256 missense probably damaging 1.00
R5267:Mycl UTSW 4 123000496 missense probably damaging 1.00
R5795:Mycl UTSW 4 122996622 missense probably damaging 1.00
R6233:Mycl UTSW 4 122999920 missense probably damaging 1.00
R6854:Mycl UTSW 4 123000246 missense probably damaging 1.00
R7050:Mycl UTSW 4 122997020 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTTGTGCAGAAGGAAACTGG -3'
(R):5'- CCCTCTTGAGAGCAACTTTCTG -3'

Sequencing Primer
(F):5'- CAGAAGGAAACTGGAGACTATTTTCC -3'
(R):5'- CTTTCTGGAGGAAAACGGGC -3'
Posted On2018-02-27