Incidental Mutation 'R6195:Tnrc18'
ID502844
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
MMRRC Submission 044335-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R6195 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142765173 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1217 (K1217N)
Ref Sequence ENSEMBL: ENSMUSP00000117651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
Predicted Effect unknown
Transcript: ENSMUST00000151477
AA Change: K1399N
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: K1399N

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: K1217N
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: K1217N

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200371
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 193,174,834 probably null Het
Abtb1 T C 6: 88,840,736 E50G probably benign Het
Agbl2 T A 2: 90,813,313 D792E probably benign Het
Aoc1 C A 6: 48,908,677 N705K probably damaging Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef7 C T 8: 11,822,017 T701I probably damaging Het
Atg10 G T 13: 91,208,436 probably null Het
Atp5c1 T C 2: 10,064,115 I116M possibly damaging Het
Baz2b T A 2: 59,907,511 Q1818L possibly damaging Het
Bod1 A G 11: 31,666,740 *174Q probably null Het
Cacna1a A G 8: 84,588,753 Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 D260G probably benign Het
Cyp1b1 G T 17: 79,714,266 L16M probably damaging Het
Dhx29 T A 13: 112,964,537 S1205T probably benign Het
Dlec1 A G 9: 119,137,253 K1097E probably benign Het
Dnah7b G A 1: 46,204,269 D1578N probably damaging Het
Dok3 T C 13: 55,523,576 N394S probably benign Het
Efhb A G 17: 53,462,552 F243S possibly damaging Het
Eif2ak2 A T 17: 78,871,233 Y137* probably null Het
Eif4e1b A G 13: 54,784,205 N34S probably null Het
F2rl3 A G 8: 72,762,885 T247A probably benign Het
Fam196a T C 7: 134,918,648 D51G probably damaging Het
Fan1 A T 7: 64,354,371 H782Q probably damaging Het
Fer1l5 T C 1: 36,375,286 probably null Het
Fer1l6 T C 15: 58,637,957 S1423P probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fgfbp1 T C 5: 43,979,362 D196G possibly damaging Het
Fxn G A 19: 24,262,043 R162C probably damaging Het
Fxr2 C T 11: 69,652,273 T632M probably benign Het
Gab1 A T 8: 80,879,532 Y24* probably null Het
Gcc2 T C 10: 58,270,984 S681P probably damaging Het
Git2 T C 5: 114,767,114 N94S probably benign Het
Gm17018 A G 19: 45,577,019 D144G probably damaging Het
Gm5538 G A 3: 59,752,202 V359I probably damaging Het
Gm5799 T G 14: 43,544,631 L87V probably damaging Het
Golga7b A T 19: 42,263,447 D44V probably benign Het
Hace1 T A 10: 45,670,443 I391N possibly damaging Het
Hmcn2 T C 2: 31,384,115 S1416P probably damaging Het
Hoxa11 G A 6: 52,245,701 R7C probably damaging Het
Igkv14-126 A T 6: 67,896,491 T68S possibly damaging Het
Itpr3 T C 17: 27,086,960 I164T probably damaging Het
Kif22 A G 7: 127,028,959 S540P probably damaging Het
Ldlr T A 9: 21,731,781 C34* probably null Het
Lrrtm4 T C 6: 80,021,956 L117P probably damaging Het
Mad2l1 G T 6: 66,537,628 G94C possibly damaging Het
Malrd1 C A 2: 15,695,326 H661Q probably damaging Het
Mical3 T A 6: 121,016,835 probably benign Het
Mipep T A 14: 60,872,105 W644R probably damaging Het
Mycl A G 4: 122,999,920 D171G probably damaging Het
Myof A G 19: 37,913,357 F997L possibly damaging Het
Nagpa C T 16: 5,203,749 R46H probably damaging Het
Nf1 A G 11: 79,565,975 Y629C probably damaging Het
Obscn T A 11: 58,997,207 E2164V probably damaging Het
Olfr1061 T C 2: 86,413,207 I282V probably damaging Het
Olfr1152 T C 2: 87,868,560 S190P possibly damaging Het
Olfr205 A G 16: 59,329,422 V29A possibly damaging Het
Olfr648 A T 7: 104,179,754 V218D possibly damaging Het
Pcdh20 T C 14: 88,468,052 E604G probably benign Het
Pcdhb7 G A 18: 37,342,656 V282I probably benign Het
Pcnx4 A G 12: 72,556,874 D523G possibly damaging Het
Pigx G A 16: 32,084,586 T219I probably damaging Het
Plch1 G T 3: 63,740,789 P399Q probably damaging Het
Pvrig T A 5: 138,342,275 F74I possibly damaging Het
Rsrp1 T A 4: 134,926,802 I255K probably damaging Het
Scn1a T A 2: 66,277,618 Y1588F possibly damaging Het
Serpina9 T A 12: 104,001,407 H243L probably damaging Het
Tapbp T C 17: 33,919,982 L41P probably damaging Het
Tbc1d16 T A 11: 119,210,565 K40* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,231,350 E6G possibly damaging Het
Tdrd6 A G 17: 43,629,752 V135A probably damaging Het
Tmem87a A T 2: 120,392,175 probably null Het
Trim33 G A 3: 103,337,532 probably null Het
Ttn T A 2: 76,737,653 Y27632F probably benign Het
Tubgcp6 A T 15: 89,122,791 D9E probably benign Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Zfp655 T A 5: 145,243,762 F143L possibly damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- AAAGTCGACCTACGGACCAG -3'
(R):5'- TCATCTTAAGTGTGGGTGCC -3'

Sequencing Primer
(F):5'- TACGGACCAGCTATCCAGGATG -3'
(R):5'- CCTGTGATCTCAGTACTCAGGAAG -3'
Posted On2018-02-27