Incidental Mutation 'R6195:Serpina9'
ID 502872
Institutional Source Beutler Lab
Gene Symbol Serpina9
Ensembl Gene ENSMUSG00000058260
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
Synonyms Centerin, 2310014L03Rik
MMRRC Submission 044335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R6195 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 103962877-103979911 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103967666 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 243 (H243L)
Ref Sequence ENSEMBL: ENSMUSP00000058535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058464]
AlphaFold Q9D7D2
Predicted Effect probably damaging
Transcript: ENSMUST00000058464
AA Change: H243L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058535
Gene: ENSMUSG00000058260
AA Change: H243L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 55 415 1.27e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176106
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 192,857,142 (GRCm39) probably null Het
Aadacl2fm2 G A 3: 59,659,623 (GRCm39) V359I probably damaging Het
Abtb1 T C 6: 88,817,718 (GRCm39) E50G probably benign Het
Agbl2 T A 2: 90,643,657 (GRCm39) D792E probably benign Het
Aoc1 C A 6: 48,885,611 (GRCm39) N705K probably damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef7 C T 8: 11,872,017 (GRCm39) T701I probably damaging Het
Atg10 G T 13: 91,356,555 (GRCm39) probably null Het
Atp5f1c T C 2: 10,068,926 (GRCm39) I116M possibly damaging Het
Baz2b T A 2: 59,737,855 (GRCm39) Q1818L possibly damaging Het
Bod1 A G 11: 31,616,740 (GRCm39) *174Q probably null Het
Cacna1a A G 8: 85,315,382 (GRCm39) Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 (GRCm39) D260G probably benign Het
Cyp1b1 G T 17: 80,021,695 (GRCm39) L16M probably damaging Het
Dhx29 T A 13: 113,101,071 (GRCm39) S1205T probably benign Het
Dlec1 A G 9: 118,966,321 (GRCm39) K1097E probably benign Het
Dnah7b G A 1: 46,243,429 (GRCm39) D1578N probably damaging Het
Dok3 T C 13: 55,671,389 (GRCm39) N394S probably benign Het
Dpcd A G 19: 45,565,458 (GRCm39) D144G probably damaging Het
Efhb A G 17: 53,769,580 (GRCm39) F243S possibly damaging Het
Eif2ak2 A T 17: 79,178,662 (GRCm39) Y137* probably null Het
Eif4e1b A G 13: 54,932,018 (GRCm39) N34S probably null Het
F2rl3 A G 8: 73,489,513 (GRCm39) T247A probably benign Het
Fan1 A T 7: 64,004,119 (GRCm39) H782Q probably damaging Het
Fer1l5 T C 1: 36,414,367 (GRCm39) probably null Het
Fer1l6 T C 15: 58,509,806 (GRCm39) S1423P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fgfbp1 T C 5: 44,136,704 (GRCm39) D196G possibly damaging Het
Fxn G A 19: 24,239,407 (GRCm39) R162C probably damaging Het
Fxr2 C T 11: 69,543,099 (GRCm39) T632M probably benign Het
Gab1 A T 8: 81,606,161 (GRCm39) Y24* probably null Het
Gcc2 T C 10: 58,106,806 (GRCm39) S681P probably damaging Het
Git2 T C 5: 114,905,175 (GRCm39) N94S probably benign Het
Gm5799 T G 14: 43,782,088 (GRCm39) L87V probably damaging Het
Golga7b A T 19: 42,251,886 (GRCm39) D44V probably benign Het
Hace1 T A 10: 45,546,539 (GRCm39) I391N possibly damaging Het
Hmcn2 T C 2: 31,274,127 (GRCm39) S1416P probably damaging Het
Hoxa11 G A 6: 52,222,681 (GRCm39) R7C probably damaging Het
Igkv14-126 A T 6: 67,873,475 (GRCm39) T68S possibly damaging Het
Insyn2a T C 7: 134,520,377 (GRCm39) D51G probably damaging Het
Itpr3 T C 17: 27,305,934 (GRCm39) I164T probably damaging Het
Kif22 A G 7: 126,628,131 (GRCm39) S540P probably damaging Het
Ldlr T A 9: 21,643,077 (GRCm39) C34* probably null Het
Lrrtm4 T C 6: 79,998,939 (GRCm39) L117P probably damaging Het
Mad2l1 G T 6: 66,514,612 (GRCm39) G94C possibly damaging Het
Malrd1 C A 2: 15,700,137 (GRCm39) H661Q probably damaging Het
Mical3 T A 6: 120,993,796 (GRCm39) probably benign Het
Mipep T A 14: 61,109,554 (GRCm39) W644R probably damaging Het
Mycl A G 4: 122,893,713 (GRCm39) D171G probably damaging Het
Myof A G 19: 37,901,805 (GRCm39) F997L possibly damaging Het
Nagpa C T 16: 5,021,613 (GRCm39) R46H probably damaging Het
Nf1 A G 11: 79,456,801 (GRCm39) Y629C probably damaging Het
Obscn T A 11: 58,888,033 (GRCm39) E2164V probably damaging Het
Or52h1 A T 7: 103,828,961 (GRCm39) V218D possibly damaging Het
Or5ac23 A G 16: 59,149,785 (GRCm39) V29A possibly damaging Het
Or5w19 T C 2: 87,698,904 (GRCm39) S190P possibly damaging Het
Or8k25 T C 2: 86,243,551 (GRCm39) I282V probably damaging Het
Pcdh20 T C 14: 88,705,488 (GRCm39) E604G probably benign Het
Pcdhb7 G A 18: 37,475,709 (GRCm39) V282I probably benign Het
Pcnx4 A G 12: 72,603,648 (GRCm39) D523G possibly damaging Het
Pigx G A 16: 31,903,404 (GRCm39) T219I probably damaging Het
Plch1 G T 3: 63,648,210 (GRCm39) P399Q probably damaging Het
Pvrig-ps T A 5: 138,340,537 (GRCm39) F74I possibly damaging Het
Rsrp1 T A 4: 134,654,113 (GRCm39) I255K probably damaging Het
Scn1a T A 2: 66,107,962 (GRCm39) Y1588F possibly damaging Het
Tapbp T C 17: 34,138,956 (GRCm39) L41P probably damaging Het
Tbc1d16 T A 11: 119,101,391 (GRCm39) K40* probably null Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tbc1d23 T C 16: 57,051,713 (GRCm39) E6G possibly damaging Het
Tdrd6 A G 17: 43,940,643 (GRCm39) V135A probably damaging Het
Tmem87a A T 2: 120,222,656 (GRCm39) probably null Het
Tnrc18 T A 5: 142,750,928 (GRCm39) K1217N unknown Het
Trim33 G A 3: 103,244,848 (GRCm39) probably null Het
Ttn T A 2: 76,567,997 (GRCm39) Y27632F probably benign Het
Tubgcp6 A T 15: 89,006,994 (GRCm39) D9E probably benign Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Zfp655 T A 5: 145,180,572 (GRCm39) F143L possibly damaging Het
Other mutations in Serpina9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Serpina9 APN 12 103,974,845 (GRCm39) missense probably damaging 1.00
IGL02228:Serpina9 APN 12 103,974,859 (GRCm39) missense probably benign 0.02
IGL02692:Serpina9 APN 12 103,974,665 (GRCm39) missense probably damaging 1.00
IGL03149:Serpina9 APN 12 103,974,869 (GRCm39) nonsense probably null
IGL03134:Serpina9 UTSW 12 103,967,696 (GRCm39) missense probably null 0.18
R0119:Serpina9 UTSW 12 103,967,729 (GRCm39) missense probably benign 0.18
R0299:Serpina9 UTSW 12 103,967,729 (GRCm39) missense probably benign 0.18
R0499:Serpina9 UTSW 12 103,967,729 (GRCm39) missense probably benign 0.18
R1477:Serpina9 UTSW 12 103,963,362 (GRCm39) missense possibly damaging 0.90
R1912:Serpina9 UTSW 12 103,967,508 (GRCm39) missense probably damaging 1.00
R2142:Serpina9 UTSW 12 103,974,568 (GRCm39) missense probably benign 0.04
R2221:Serpina9 UTSW 12 103,964,523 (GRCm39) missense probably damaging 0.98
R2413:Serpina9 UTSW 12 103,967,485 (GRCm39) critical splice donor site probably null
R3939:Serpina9 UTSW 12 103,975,151 (GRCm39) start codon destroyed probably benign 0.01
R4515:Serpina9 UTSW 12 103,967,553 (GRCm39) missense probably benign 0.14
R5242:Serpina9 UTSW 12 103,974,644 (GRCm39) missense probably benign 0.09
R5589:Serpina9 UTSW 12 103,967,728 (GRCm39) missense probably benign 0.00
R5900:Serpina9 UTSW 12 103,975,130 (GRCm39) nonsense probably null
R6171:Serpina9 UTSW 12 103,974,678 (GRCm39) nonsense probably null
R6566:Serpina9 UTSW 12 103,963,296 (GRCm39) missense possibly damaging 0.61
R6995:Serpina9 UTSW 12 103,967,495 (GRCm39) missense probably damaging 1.00
R7762:Serpina9 UTSW 12 103,967,575 (GRCm39) missense probably damaging 0.98
R7808:Serpina9 UTSW 12 103,967,484 (GRCm39) critical splice donor site probably null
R7860:Serpina9 UTSW 12 103,967,680 (GRCm39) missense probably benign 0.01
R7935:Serpina9 UTSW 12 103,964,421 (GRCm39) missense probably damaging 1.00
R9041:Serpina9 UTSW 12 103,967,737 (GRCm39) missense
Z1176:Serpina9 UTSW 12 103,967,543 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTGACAGTGATGCTTACC -3'
(R):5'- CCTTGCAGCTTTCAGGGTTG -3'

Sequencing Primer
(F):5'- AAGCTGACAGTGATGCTTACCTTTTC -3'
(R):5'- CTTTCAGGGTTGTAAAGCGCCC -3'
Posted On 2018-02-27