Incidental Mutation 'R6195:Or5ac23'
ID 502886
Institutional Source Beutler Lab
Gene Symbol Or5ac23
Ensembl Gene ENSMUSG00000094422
Gene Name olfactory receptor family 5 subfamily AC member 23
Synonyms Olfr205, MOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission 044335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6195 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59148953-59149870 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59149785 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
AlphaFold Q7TS37
Predicted Effect possibly damaging
Transcript: ENSMUST00000074125
AA Change: V29A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: V29A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213910
AA Change: V29A

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.2105 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A G 1: 192,857,142 (GRCm39) probably null Het
Aadacl2fm2 G A 3: 59,659,623 (GRCm39) V359I probably damaging Het
Abtb1 T C 6: 88,817,718 (GRCm39) E50G probably benign Het
Agbl2 T A 2: 90,643,657 (GRCm39) D792E probably benign Het
Aoc1 C A 6: 48,885,611 (GRCm39) N705K probably damaging Het
Araf G T X: 20,726,339 (GRCm39) R601L probably damaging Homo
Arhgef7 C T 8: 11,872,017 (GRCm39) T701I probably damaging Het
Atg10 G T 13: 91,356,555 (GRCm39) probably null Het
Atp5f1c T C 2: 10,068,926 (GRCm39) I116M possibly damaging Het
Baz2b T A 2: 59,737,855 (GRCm39) Q1818L possibly damaging Het
Bod1 A G 11: 31,616,740 (GRCm39) *174Q probably null Het
Cacna1a A G 8: 85,315,382 (GRCm39) Y1539C probably damaging Het
Creb3 A G 4: 43,566,346 (GRCm39) D260G probably benign Het
Cyp1b1 G T 17: 80,021,695 (GRCm39) L16M probably damaging Het
Dhx29 T A 13: 113,101,071 (GRCm39) S1205T probably benign Het
Dlec1 A G 9: 118,966,321 (GRCm39) K1097E probably benign Het
Dnah7b G A 1: 46,243,429 (GRCm39) D1578N probably damaging Het
Dok3 T C 13: 55,671,389 (GRCm39) N394S probably benign Het
Dpcd A G 19: 45,565,458 (GRCm39) D144G probably damaging Het
Efhb A G 17: 53,769,580 (GRCm39) F243S possibly damaging Het
Eif2ak2 A T 17: 79,178,662 (GRCm39) Y137* probably null Het
Eif4e1b A G 13: 54,932,018 (GRCm39) N34S probably null Het
F2rl3 A G 8: 73,489,513 (GRCm39) T247A probably benign Het
Fan1 A T 7: 64,004,119 (GRCm39) H782Q probably damaging Het
Fer1l5 T C 1: 36,414,367 (GRCm39) probably null Het
Fer1l6 T C 15: 58,509,806 (GRCm39) S1423P probably damaging Het
Fetub C T 16: 22,751,081 (GRCm39) R143C probably damaging Het
Fgfbp1 T C 5: 44,136,704 (GRCm39) D196G possibly damaging Het
Fxn G A 19: 24,239,407 (GRCm39) R162C probably damaging Het
Fxr2 C T 11: 69,543,099 (GRCm39) T632M probably benign Het
Gab1 A T 8: 81,606,161 (GRCm39) Y24* probably null Het
Gcc2 T C 10: 58,106,806 (GRCm39) S681P probably damaging Het
Git2 T C 5: 114,905,175 (GRCm39) N94S probably benign Het
Gm5799 T G 14: 43,782,088 (GRCm39) L87V probably damaging Het
Golga7b A T 19: 42,251,886 (GRCm39) D44V probably benign Het
Hace1 T A 10: 45,546,539 (GRCm39) I391N possibly damaging Het
Hmcn2 T C 2: 31,274,127 (GRCm39) S1416P probably damaging Het
Hoxa11 G A 6: 52,222,681 (GRCm39) R7C probably damaging Het
Igkv14-126 A T 6: 67,873,475 (GRCm39) T68S possibly damaging Het
Insyn2a T C 7: 134,520,377 (GRCm39) D51G probably damaging Het
Itpr3 T C 17: 27,305,934 (GRCm39) I164T probably damaging Het
Kif22 A G 7: 126,628,131 (GRCm39) S540P probably damaging Het
Ldlr T A 9: 21,643,077 (GRCm39) C34* probably null Het
Lrrtm4 T C 6: 79,998,939 (GRCm39) L117P probably damaging Het
Mad2l1 G T 6: 66,514,612 (GRCm39) G94C possibly damaging Het
Malrd1 C A 2: 15,700,137 (GRCm39) H661Q probably damaging Het
Mical3 T A 6: 120,993,796 (GRCm39) probably benign Het
Mipep T A 14: 61,109,554 (GRCm39) W644R probably damaging Het
Mycl A G 4: 122,893,713 (GRCm39) D171G probably damaging Het
Myof A G 19: 37,901,805 (GRCm39) F997L possibly damaging Het
Nagpa C T 16: 5,021,613 (GRCm39) R46H probably damaging Het
Nf1 A G 11: 79,456,801 (GRCm39) Y629C probably damaging Het
Obscn T A 11: 58,888,033 (GRCm39) E2164V probably damaging Het
Or52h1 A T 7: 103,828,961 (GRCm39) V218D possibly damaging Het
Or5w19 T C 2: 87,698,904 (GRCm39) S190P possibly damaging Het
Or8k25 T C 2: 86,243,551 (GRCm39) I282V probably damaging Het
Pcdh20 T C 14: 88,705,488 (GRCm39) E604G probably benign Het
Pcdhb7 G A 18: 37,475,709 (GRCm39) V282I probably benign Het
Pcnx4 A G 12: 72,603,648 (GRCm39) D523G possibly damaging Het
Pigx G A 16: 31,903,404 (GRCm39) T219I probably damaging Het
Plch1 G T 3: 63,648,210 (GRCm39) P399Q probably damaging Het
Pvrig-ps T A 5: 138,340,537 (GRCm39) F74I possibly damaging Het
Rsrp1 T A 4: 134,654,113 (GRCm39) I255K probably damaging Het
Scn1a T A 2: 66,107,962 (GRCm39) Y1588F possibly damaging Het
Serpina9 T A 12: 103,967,666 (GRCm39) H243L probably damaging Het
Tapbp T C 17: 34,138,956 (GRCm39) L41P probably damaging Het
Tbc1d16 T A 11: 119,101,391 (GRCm39) K40* probably null Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tbc1d23 T C 16: 57,051,713 (GRCm39) E6G possibly damaging Het
Tdrd6 A G 17: 43,940,643 (GRCm39) V135A probably damaging Het
Tmem87a A T 2: 120,222,656 (GRCm39) probably null Het
Tnrc18 T A 5: 142,750,928 (GRCm39) K1217N unknown Het
Trim33 G A 3: 103,244,848 (GRCm39) probably null Het
Ttn T A 2: 76,567,997 (GRCm39) Y27632F probably benign Het
Tubgcp6 A T 15: 89,006,994 (GRCm39) D9E probably benign Het
Uaca G A 9: 60,777,326 (GRCm39) R571Q probably damaging Het
Zfp655 T A 5: 145,180,572 (GRCm39) F143L possibly damaging Het
Other mutations in Or5ac23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Or5ac23 APN 16 59,149,088 (GRCm39) missense probably benign 0.21
IGL03236:Or5ac23 APN 16 59,149,200 (GRCm39) missense probably damaging 0.97
R0054:Or5ac23 UTSW 16 59,149,428 (GRCm39) missense possibly damaging 0.57
R0054:Or5ac23 UTSW 16 59,149,428 (GRCm39) missense possibly damaging 0.57
R0167:Or5ac23 UTSW 16 59,149,337 (GRCm39) nonsense probably null
R0178:Or5ac23 UTSW 16 59,149,783 (GRCm39) missense probably damaging 1.00
R0371:Or5ac23 UTSW 16 59,149,585 (GRCm39) missense possibly damaging 0.60
R0577:Or5ac23 UTSW 16 59,149,061 (GRCm39) missense probably benign 0.01
R0597:Or5ac23 UTSW 16 59,149,123 (GRCm39) missense probably damaging 1.00
R0967:Or5ac23 UTSW 16 59,149,546 (GRCm39) missense possibly damaging 0.66
R1670:Or5ac23 UTSW 16 59,149,607 (GRCm39) missense probably benign 0.03
R1702:Or5ac23 UTSW 16 59,149,504 (GRCm39) missense probably benign 0.12
R1995:Or5ac23 UTSW 16 59,149,654 (GRCm39) missense probably damaging 1.00
R2239:Or5ac23 UTSW 16 59,149,738 (GRCm39) missense probably damaging 0.99
R4063:Or5ac23 UTSW 16 59,149,243 (GRCm39) missense probably benign 0.05
R4400:Or5ac23 UTSW 16 59,148,961 (GRCm39) missense probably benign
R4666:Or5ac23 UTSW 16 59,149,573 (GRCm39) missense possibly damaging 0.91
R4795:Or5ac23 UTSW 16 59,149,213 (GRCm39) missense probably benign 0.09
R5327:Or5ac23 UTSW 16 59,149,461 (GRCm39) missense probably benign 0.01
R5471:Or5ac23 UTSW 16 59,148,994 (GRCm39) missense probably damaging 1.00
R5770:Or5ac23 UTSW 16 59,149,514 (GRCm39) nonsense probably null
R6702:Or5ac23 UTSW 16 59,148,961 (GRCm39) missense probably benign
R7686:Or5ac23 UTSW 16 59,149,379 (GRCm39) missense probably damaging 1.00
R7908:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7911:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7912:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7913:Or5ac23 UTSW 16 59,149,606 (GRCm39) missense possibly damaging 0.48
R7998:Or5ac23 UTSW 16 59,149,633 (GRCm39) missense probably benign 0.09
R8772:Or5ac23 UTSW 16 59,149,051 (GRCm39) missense probably damaging 1.00
R9563:Or5ac23 UTSW 16 59,149,765 (GRCm39) missense probably benign 0.00
X0026:Or5ac23 UTSW 16 59,149,713 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCTACCAGGAGGAAAATTTCAG -3'
(R):5'- CCTGACATGTGTGAAAGAGGAC -3'

Sequencing Primer
(F):5'- ATTTCAGTAGTTGCACTGAAGC -3'
(R):5'- CATGTGTGAAAGAGGACTATGATCTG -3'
Posted On 2018-02-27