Incidental Mutation 'R6196:Tanc1'
ID502905
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59844022 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1817 (E1817K)
Ref Sequence ENSEMBL: ENSMUSP00000108187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037526
AA Change: E1824K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: E1824K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112568
AA Change: E1817K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: E1817K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139863
AA Change: E1824K

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: E1824K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147650
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Atp6v1c2 C A 12: 17,301,186 E105* probably null Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Ctsr A T 13: 61,160,531 H266Q probably benign Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1 G A 11: 73,395,473 A183V probably benign Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trpm7 G A 2: 126,825,639 P811S possibly damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCAAGCCAGGAGGATAC -3'
(R):5'- TGGCATCAGATCCACCCAAG -3'

Sequencing Primer
(F):5'- CTGTAGCCAAGCCAAACCGTG -3'
(R):5'- GAGGTGGAAAATATGGCTAACATG -3'
Posted On2018-02-27