Incidental Mutation 'R6196:Olfr1'
ID502931
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73395473 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 183 (A183V)
Ref Sequence ENSEMBL: ENSMUSP00000113707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably benign
Transcript: ENSMUST00000120303
AA Change: A183V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: A183V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131253
AA Change: A183V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823
AA Change: A183V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Atp6v1c2 C A 12: 17,301,186 E105* probably null Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Ctsr A T 13: 61,160,531 H266Q probably benign Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trpm7 G A 2: 126,825,639 P811S possibly damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTGTCCCATAGAACAGTGACAC -3'
(R):5'- CGCTATGTGGCCATCTGTTACC -3'

Sequencing Primer
(F):5'- TGACACTACAGACAGGTGAGATCC -3'
(R):5'- CCCCTTCATTACACCACCATCATG -3'
Posted On2018-02-27