Incidental Mutation 'R6196:Atp6v1c2'
ID502937
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 17301186 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 105 (E105*)
Ref Sequence ENSEMBL: ENSMUSP00000152515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000153090] [ENSMUST00000156727] [ENSMUST00000221129] [ENSMUST00000222103]
Predicted Effect probably null
Transcript: ENSMUST00000020884
AA Change: E115*
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566
AA Change: E115*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095820
AA Change: E105*
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566
AA Change: E105*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140751
AA Change: E105*
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566
AA Change: E105*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153090
AA Change: E105*
SMART Domains Protein: ENSMUSP00000119686
Gene: ENSMUSG00000020566
AA Change: E105*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 134 3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156727
AA Change: E35*
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566
AA Change: E35*

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000221129
AA Change: E105*
Predicted Effect probably benign
Transcript: ENSMUST00000222103
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Ctsr A T 13: 61,160,531 H266Q probably benign Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1 G A 11: 73,395,473 A183V probably benign Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trpm7 G A 2: 126,825,639 P811S possibly damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0358:Atp6v1c2 UTSW 12 17284960 splice site probably benign
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R0536:Atp6v1c2 UTSW 12 17307508 splice site probably null
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4695:Atp6v1c2 UTSW 12 17301207 missense probably benign 0.02
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R5215:Atp6v1c2 UTSW 12 17291658 missense probably benign 0.08
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R7059:Atp6v1c2 UTSW 12 17289004 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TACATAGGGTCACTCAGGGG -3'
(R):5'- TTGAACTGCTCCCTCATGG -3'

Sequencing Primer
(F):5'- TCACTCAGGGGCTAGCATC -3'
(R):5'- ATGGAGCATCTGCACTTCCAGAG -3'
Posted On2018-02-27