Incidental Mutation 'R6196:Cdc14b'
ID502943
Institutional Source Beutler Lab
Gene Symbol Cdc14b
Ensembl Gene ENSMUSG00000033102
Gene NameCDC14 cell division cycle 14B
SynonymsA530086E13Rik, 2810432N10Rik
MMRRC Submission 044336-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6196 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location64189268-64275290 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 64205524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039318] [ENSMUST00000109769] [ENSMUST00000109770] [ENSMUST00000221139] [ENSMUST00000221634] [ENSMUST00000222766]
Predicted Effect probably benign
Transcript: ENSMUST00000039318
SMART Domains Protein: ENSMUSP00000046003
Gene: ENSMUSG00000033102

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 6.1e-57 PFAM
Pfam:DSPc 240 365 9.2e-17 PFAM
Pfam:Y_phosphatase 244 365 1e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109769
SMART Domains Protein: ENSMUSP00000105391
Gene: ENSMUSG00000033102

DomainStartEndE-ValueType
Pfam:DSPn 12 152 2.5e-58 PFAM
Pfam:DSPc 203 328 8e-17 PFAM
Pfam:Y_phosphatase 206 328 8.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109770
SMART Domains Protein: ENSMUSP00000105392
Gene: ENSMUSG00000033102

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 3.4e-57 PFAM
Pfam:DSPc 240 365 2.8e-16 PFAM
Pfam:Y_phosphatase 252 364 2.4e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221139
Predicted Effect probably benign
Transcript: ENSMUST00000221217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221567
Predicted Effect probably benign
Transcript: ENSMUST00000221634
Predicted Effect unknown
Transcript: ENSMUST00000222713
AA Change: G127D
Predicted Effect probably benign
Transcript: ENSMUST00000222766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223116
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature aging, including premature cataracts and kyphosis; reduced fertility, particularly in female mice; and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A T 8: 105,709,922 H241L possibly damaging Het
Acap1 T C 11: 69,887,067 D115G probably damaging Het
Acvr2b T C 9: 119,433,403 V510A possibly damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Agr2 A T 12: 35,995,592 K26* probably null Het
Aox4 T A 1: 58,217,526 I69N probably damaging Het
Asb4 G A 6: 5,390,699 G31R probably benign Het
Atp6v1c2 C A 12: 17,301,186 E105* probably null Het
Bend6 A G 1: 33,878,428 Y44H probably damaging Het
Btn2a2 C T 13: 23,487,845 V25M possibly damaging Het
Cab39l T A 14: 59,499,590 L53Q probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cenpu A G 8: 46,562,580 R177G probably benign Het
Chit1 C A 1: 134,146,643 Y229* probably null Het
Crybg2 C A 4: 134,081,139 S1350R probably damaging Het
Ctdspl2 A G 2: 121,978,892 probably null Het
Ctsr A T 13: 61,160,531 H266Q probably benign Het
Extl3 T A 14: 65,076,135 M533L probably benign Het
Fam162b C A 10: 51,587,410 probably null Het
Fbxo28 T C 1: 182,329,889 K121R probably damaging Het
Fsip2 A C 2: 82,989,883 E5320A possibly damaging Het
Galc A T 12: 98,259,162 D56E probably damaging Het
Gm11639 T G 11: 104,855,560 I2279S probably benign Het
Gm5468 A G 15: 25,414,395 probably benign Het
Hk1 T A 10: 62,299,259 H24L probably damaging Het
Igkv5-45 A G 6: 69,775,981 V39A possibly damaging Het
Lemd2 G A 17: 27,193,002 Q439* probably null Het
Lgi1 A G 19: 38,305,809 N295S probably benign Het
Macc1 T G 12: 119,446,050 S184R probably damaging Het
Msmo1 A G 8: 64,727,884 probably benign Het
Muc5b C A 7: 141,851,596 R914S unknown Het
Olfr1 G A 11: 73,395,473 A183V probably benign Het
Olfr1464-ps1 A G 19: 13,282,926 I44T probably benign Het
Olfr23 G A 11: 73,940,809 A188T possibly damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Olfr959 G A 9: 39,572,480 P260S possibly damaging Het
Plekha5 T C 6: 140,579,453 S14P probably benign Het
Pus10 A G 11: 23,672,638 K86R probably benign Het
Rab37 T C 11: 115,160,306 V147A probably benign Het
Sin3a T A 9: 57,103,929 I490N probably damaging Het
Slc27a4 A G 2: 29,805,750 D99G probably benign Het
Slc43a2 C T 11: 75,568,380 R413* probably null Het
Syna G T 5: 134,559,612 T161N probably benign Het
T A G 17: 8,437,164 D86G possibly damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Tap2 C A 17: 34,214,410 Q516K possibly damaging Het
Tcaf1 A T 6: 42,676,807 D717E probably damaging Het
Tcf20 G T 15: 82,851,986 Q1755K possibly damaging Het
Tctex1d1 A G 4: 102,992,569 E63G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trpm7 G A 2: 126,825,639 P811S possibly damaging Het
Uhrf1bp1l T G 10: 89,805,333 S789A probably benign Het
Vmn2r59 A G 7: 42,012,255 V712A probably benign Het
Vwc2l T A 1: 70,729,021 D34E probably damaging Het
Wdr35 A G 12: 9,027,632 K1091E probably benign Het
Other mutations in Cdc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cdc14b APN 13 64215656 missense probably damaging 1.00
IGL00816:Cdc14b APN 13 64205403 missense probably benign 0.10
IGL02569:Cdc14b APN 13 64225614 missense probably benign 0.36
IGL02634:Cdc14b APN 13 64216303 splice site probably benign
IGL02897:Cdc14b APN 13 64247253 missense probably benign 0.00
R0390:Cdc14b UTSW 13 64210192 unclassified probably benign
R0542:Cdc14b UTSW 13 64243683 missense probably benign 0.01
R1022:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1024:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1676:Cdc14b UTSW 13 64225602 missense possibly damaging 0.93
R1945:Cdc14b UTSW 13 64219890 missense probably damaging 1.00
R1964:Cdc14b UTSW 13 64215537 missense probably damaging 1.00
R3162:Cdc14b UTSW 13 64246608 splice site probably benign
R4359:Cdc14b UTSW 13 64248411 missense probably benign 0.27
R4598:Cdc14b UTSW 13 64247274 missense probably benign
R4716:Cdc14b UTSW 13 64209200 missense probably damaging 1.00
R6219:Cdc14b UTSW 13 64205524 intron probably benign
R6361:Cdc14b UTSW 13 64216209 splice site probably null
R6480:Cdc14b UTSW 13 64225650 critical splice acceptor site probably null
R6565:Cdc14b UTSW 13 64225630 missense probably benign 0.01
R6692:Cdc14b UTSW 13 64215563 missense probably damaging 0.98
R7204:Cdc14b UTSW 13 64210198 missense possibly damaging 0.83
R7327:Cdc14b UTSW 13 64225647 missense probably damaging 1.00
R7464:Cdc14b UTSW 13 64196675 nonsense probably null
R7639:Cdc14b UTSW 13 64205329 missense possibly damaging 0.96
R7687:Cdc14b UTSW 13 64209193 missense probably benign 0.15
R7949:Cdc14b UTSW 13 64190398 splice site probably null
R8170:Cdc14b UTSW 13 64215735 splice site probably null
Z1176:Cdc14b UTSW 13 64274669 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGCTACTGTGTTCTGAAGC -3'
(R):5'- CATATCTAAGGATGGCCAGCTGG -3'

Sequencing Primer
(F):5'- CTGTGTTCTGAAGCCATCAAGACAG -3'
(R):5'- CAGCTGGAGTACTGTCAGTC -3'
Posted On2018-02-27