Mutagenetix > Incidental Mutations

Incidental Mutation 'R6196:Top2b'

502944

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

044336-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R6196 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 16409189 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 777 (I777M)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159302

SMART Domains

Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	1	177	4.06e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160501

SMART Domains

Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	2	222	3.97e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161693

SMART Domains

Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
Pfam:DNA_topoisoIV	1	117	1.2e-12	PFAM
low complexity region	161	173	N/A	INTRINSIC
low complexity region	198	210	N/A	INTRINSIC
low complexity region	234	256	N/A	INTRINSIC

Meta Mutation Damage Score

0.8018

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	A	T	8: 105,709,922	H241L	possibly damaging	Het
Acap1	T	C	11: 69,887,067	D115G	probably damaging	Het
Acvr2b	T	C	9: 119,433,403	V510A	possibly damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Agr2	A	T	12: 35,995,592	K26*	probably null	Het
Aox4	T	A	1: 58,217,526	I69N	probably damaging	Het
Asb4	G	A	6: 5,390,699	G31R	probably benign	Het
Atp6v1c2	C	A	12: 17,301,186	E105*	probably null	Het
Bend6	A	G	1: 33,878,428	Y44H	probably damaging	Het
Btn2a2	C	T	13: 23,487,845	V25M	possibly damaging	Het
Cab39l	T	A	14: 59,499,590	L53Q	probably damaging	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Cdc14b	C	T	13: 64,205,524		probably benign	Het
Cenpu	A	G	8: 46,562,580	R177G	probably benign	Het
Chit1	C	A	1: 134,146,643	Y229*	probably null	Het
Crybg2	C	A	4: 134,081,139	S1350R	probably damaging	Het
Ctdspl2	A	G	2: 121,978,892		probably null	Het
Ctsr	A	T	13: 61,160,531	H266Q	probably benign	Het
Extl3	T	A	14: 65,076,135	M533L	probably benign	Het
Fam162b	C	A	10: 51,587,410		probably null	Het
Fbxo28	T	C	1: 182,329,889	K121R	probably damaging	Het
Fsip2	A	C	2: 82,989,883	E5320A	possibly damaging	Het
Galc	A	T	12: 98,259,162	D56E	probably damaging	Het
Gm11639	T	G	11: 104,855,560	I2279S	probably benign	Het
Gm5468	A	G	15: 25,414,395		probably benign	Het
Hk1	T	A	10: 62,299,259	H24L	probably damaging	Het
Igkv5-45	A	G	6: 69,775,981	V39A	possibly damaging	Het
Lemd2	G	A	17: 27,193,002	Q439*	probably null	Het
Lgi1	A	G	19: 38,305,809	N295S	probably benign	Het
Macc1	T	G	12: 119,446,050	S184R	probably damaging	Het
Msmo1	A	G	8: 64,727,884		probably benign	Het
Muc5b	C	A	7: 141,851,596	R914S	unknown	Het
Olfr1	G	A	11: 73,395,473	A183V	probably benign	Het
Olfr1464-ps1	A	G	19: 13,282,926	I44T	probably benign	Het
Olfr23	G	A	11: 73,940,809	A188T	possibly damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Olfr959	G	A	9: 39,572,480	P260S	possibly damaging	Het
Plekha5	T	C	6: 140,579,453	S14P	probably benign	Het
Pus10	A	G	11: 23,672,638	K86R	probably benign	Het
Rab37	T	C	11: 115,160,306	V147A	probably benign	Het
Sin3a	T	A	9: 57,103,929	I490N	probably damaging	Het
Slc27a4	A	G	2: 29,805,750	D99G	probably benign	Het
Slc43a2	C	T	11: 75,568,380	R413*	probably null	Het
Syna	G	T	5: 134,559,612	T161N	probably benign	Het
T	A	G	17: 8,437,164	D86G	possibly damaging	Het
Tanc1	G	A	2: 59,844,022	E1817K	possibly damaging	Het
Tap2	C	A	17: 34,214,410	Q516K	possibly damaging	Het
Tcaf1	A	T	6: 42,676,807	D717E	probably damaging	Het
Tcf20	G	T	15: 82,851,986	Q1755K	possibly damaging	Het
Tctex1d1	A	G	4: 102,992,569	E63G	possibly damaging	Het
Trpm7	G	A	2: 126,825,639	P811S	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,805,333	S789A	probably benign	Het
Vmn2r59	A	G	7: 42,012,255	V712A	probably benign	Het
Vwc2l	T	A	1: 70,729,021	D34E	probably damaging	Het
Wdr35	A	G	12: 9,027,632	K1091E	probably benign	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R7977:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TTTGAAGTACTCTCCCTGAGC -3'

Sequencing Primer
(F):5'- CTGAAGATGGGATCAACTGAGAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'

Posted On

2018-02-27