Incidental Mutation 'R6197:Sephs2'
ID502980
Institutional Source Beutler Lab
Gene Symbol Sephs2
Ensembl Gene ENSMUSG00000049091
Gene Nameselenophosphate synthetase 2
SynonymsSps2, Ysg3
MMRRC Submission 044337-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R6197 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127271879-127274055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127272901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 340 (V340E)
Ref Sequence ENSEMBL: ENSMUSP00000081009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082428]
Predicted Effect probably damaging
Transcript: ENSMUST00000082428
AA Change: V340E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081009
Gene: ENSMUSG00000049091
AA Change: V340E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
Pfam:AIRS 118 234 1e-10 PFAM
Pfam:AIRS_C 246 421 2.3e-30 PFAM
low complexity region 433 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206759
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 92% (49/53)
MGI Phenotype FUNCTION: This gene encodes an enzyme that synthesizes selenophosphate from selenide and ATP. Selenophosphate is the selenium donor used to synthesize selenocysteine (Sec) that is co-translationally incorporated into selenoproteins at in-frame UGA codons, which normally signal translation termination. This protein itself contains a Sec residue in its predicted active site. The 3' UTR of this gene has a stem-loop secondary structure called a selenocysteine insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,005 I248T probably benign Het
1700109H08Rik T A 5: 3,580,442 Y119* probably null Het
Abcb9 C A 5: 124,071,749 E664* probably null Het
Adgrl2 T C 3: 148,858,942 D334G probably damaging Het
Ak9 T G 10: 41,317,830 C57G probably damaging Het
Als2cl A G 9: 110,895,884 K809E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp11a A G 8: 12,846,099 I223V probably benign Het
Cacna2d3 A T 14: 28,908,321 V1022E probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cd37 A G 7: 45,237,174 C85R probably damaging Het
Ces1g T C 8: 93,337,136 S7G probably benign Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnbd2 A G 2: 156,375,574 E661G possibly damaging Het
Col6a3 A T 1: 90,822,341 F257Y probably damaging Het
Cpt1b T C 15: 89,424,834 Y55C possibly damaging Het
Csmd1 A G 8: 15,926,611 V2869A probably benign Het
Dnah11 T C 12: 118,179,747 E387G probably benign Het
Eny2 T A 15: 44,429,553 probably null Het
Fbxo10 G T 4: 45,043,857 H655Q probably benign Het
Gm13089 T C 4: 143,697,316 Y301C possibly damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gpx2 C T 12: 76,795,294 G28S probably damaging Het
H2-Q5 G T 17: 35,394,942 A156S probably benign Het
Hoxd4 A G 2: 74,728,463 D210G possibly damaging Het
Hoxd9 A G 2: 74,698,822 Q256R probably damaging Het
Macf1 A G 4: 123,452,292 V2571A probably damaging Het
Mtus1 A G 8: 41,084,037 V214A possibly damaging Het
Myh1 C T 11: 67,220,967 A1716V probably benign Het
Nbeal1 A G 1: 60,222,128 D249G probably damaging Het
Nup54 TCTGCTGCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTGCTGCTG 5: 92,430,804 probably benign Het
Olfr1141 C T 2: 87,753,352 V214I probably benign Het
Olfr1232 A T 2: 89,325,333 N282K probably damaging Het
Olfr1353 T G 10: 78,970,140 L164V probably damaging Het
Olfr1418 G T 19: 11,855,784 H56Q probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pwwp2a A G 11: 43,704,596 D196G probably benign Het
Rarg A T 15: 102,241,892 C93S possibly damaging Het
Rcc1 T C 4: 132,337,762 D150G possibly damaging Het
Ripk2 A G 4: 16,163,330 Y23H probably damaging Het
Rragc A G 4: 123,917,547 Y5C possibly damaging Het
Rubcnl G A 14: 75,031,929 G9D probably damaging Het
Slc22a3 C T 17: 12,458,551 M243I probably benign Het
Slco6c1 A G 1: 97,072,793 probably null Het
Sncaip T G 18: 52,906,894 I308R probably damaging Het
Supt16 G A 14: 52,170,881 T869M probably damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Usp4 C A 9: 108,370,955 Q395K probably damaging Het
Usp49 T A 17: 47,673,347 S210T possibly damaging Het
Virma A G 4: 11,505,498 I124M probably damaging Het
Vmn1r234 G A 17: 21,229,327 V168I probably benign Het
Vnn3 T A 10: 23,856,289 C146S probably damaging Het
Ylpm1 A G 12: 85,042,179 D1234G probably damaging Het
Zfp617 T A 8: 71,933,254 V476E probably benign Het
Other mutations in Sephs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Sephs2 APN 7 127273087 missense probably benign 0.43
IGL03006:Sephs2 APN 7 127273034 missense probably benign
IGL03295:Sephs2 APN 7 127272769 missense possibly damaging 0.60
R1381:Sephs2 UTSW 7 127272967 missense probably damaging 1.00
R2259:Sephs2 UTSW 7 127273477 missense possibly damaging 0.80
R4876:Sephs2 UTSW 7 127273047 nonsense probably null
R5054:Sephs2 UTSW 7 127273392 missense probably benign 0.05
R5432:Sephs2 UTSW 7 127273805 missense probably damaging 1.00
R6237:Sephs2 UTSW 7 127273946 start gained probably benign
R7138:Sephs2 UTSW 7 127273015 missense possibly damaging 0.96
R7181:Sephs2 UTSW 7 127273820 missense probably benign
R7601:Sephs2 UTSW 7 127272946 missense probably damaging 1.00
R7685:Sephs2 UTSW 7 127273334 missense possibly damaging 0.46
X0061:Sephs2 UTSW 7 127273555 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCTCCACGATGCCAACGATC -3'
(R):5'- AATCAAGATGGTGGTTTCCAGAG -3'

Sequencing Primer
(F):5'- GTGACCCTCTCCGTACTTGGAAG -3'
(R):5'- CAGAGAGGAAGTAGAGTTAGCCTATC -3'
Posted On2018-02-27