Incidental Mutation 'R6197:Cacna2d3'
ID502997
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 3
Synonymsalpha2delta3, alpha 2 delta-3
MMRRC Submission 044337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6197 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location28904943-29721864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28908321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1022 (V1022E)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
Predicted Effect probably benign
Transcript: ENSMUST00000022567
AA Change: V1022E

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: V1022E

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225668
Predicted Effect probably benign
Transcript: ENSMUST00000225985
AA Change: V195E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 92% (49/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,005 I248T probably benign Het
1700109H08Rik T A 5: 3,580,442 Y119* probably null Het
Abcb9 C A 5: 124,071,749 E664* probably null Het
Adgrl2 T C 3: 148,858,942 D334G probably damaging Het
Ak9 T G 10: 41,317,830 C57G probably damaging Het
Als2cl A G 9: 110,895,884 K809E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp11a A G 8: 12,846,099 I223V probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cd37 A G 7: 45,237,174 C85R probably damaging Het
Ces1g T C 8: 93,337,136 S7G probably benign Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnbd2 A G 2: 156,375,574 E661G possibly damaging Het
Col6a3 A T 1: 90,822,341 F257Y probably damaging Het
Cpt1b T C 15: 89,424,834 Y55C possibly damaging Het
Csmd1 A G 8: 15,926,611 V2869A probably benign Het
Dnah11 T C 12: 118,179,747 E387G probably benign Het
Eny2 T A 15: 44,429,553 probably null Het
Fbxo10 G T 4: 45,043,857 H655Q probably benign Het
Gm13089 T C 4: 143,697,316 Y301C possibly damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gpx2 C T 12: 76,795,294 G28S probably damaging Het
H2-Q5 G T 17: 35,394,942 A156S probably benign Het
Hoxd4 A G 2: 74,728,463 D210G possibly damaging Het
Hoxd9 A G 2: 74,698,822 Q256R probably damaging Het
Macf1 A G 4: 123,452,292 V2571A probably damaging Het
Mtus1 A G 8: 41,084,037 V214A possibly damaging Het
Myh1 C T 11: 67,220,967 A1716V probably benign Het
Nbeal1 A G 1: 60,222,128 D249G probably damaging Het
Nup54 TCTGCTGCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTGCTGCTG 5: 92,430,804 probably benign Het
Olfr1141 C T 2: 87,753,352 V214I probably benign Het
Olfr1232 A T 2: 89,325,333 N282K probably damaging Het
Olfr1353 T G 10: 78,970,140 L164V probably damaging Het
Olfr1418 G T 19: 11,855,784 H56Q probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pwwp2a A G 11: 43,704,596 D196G probably benign Het
Rarg A T 15: 102,241,892 C93S possibly damaging Het
Rcc1 T C 4: 132,337,762 D150G possibly damaging Het
Ripk2 A G 4: 16,163,330 Y23H probably damaging Het
Rragc A G 4: 123,917,547 Y5C possibly damaging Het
Rubcnl G A 14: 75,031,929 G9D probably damaging Het
Sephs2 A T 7: 127,272,901 V340E probably damaging Het
Slc22a3 C T 17: 12,458,551 M243I probably benign Het
Slco6c1 A G 1: 97,072,793 probably null Het
Sncaip T G 18: 52,906,894 I308R probably damaging Het
Supt16 G A 14: 52,170,881 T869M probably damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Usp4 C A 9: 108,370,955 Q395K probably damaging Het
Usp49 T A 17: 47,673,347 S210T possibly damaging Het
Virma A G 4: 11,505,498 I124M probably damaging Het
Vmn1r234 G A 17: 21,229,327 V168I probably benign Het
Vnn3 T A 10: 23,856,289 C146S probably damaging Het
Ylpm1 A G 12: 85,042,179 D1234G probably damaging Het
Zfp617 T A 8: 71,933,254 V476E probably benign Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACCACTTCCCTCTGGATGC -3'
(R):5'- GAAGGGAAATGCTCTCATCCATC -3'

Sequencing Primer
(F):5'- TCCCTCTGGATGCAGGTAAACAATG -3'
(R):5'- ATGCAATGTGACCAGCTGTC -3'
Posted On2018-02-27