Incidental Mutation 'R6197:Supt16'
ID 502998
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 044337-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R6197 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52170881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 869 (T869M)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: T869M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: T869M

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 92% (49/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,921,005 I248T probably benign Het
1700109H08Rik T A 5: 3,580,442 Y119* probably null Het
Abcb9 C A 5: 124,071,749 E664* probably null Het
Adgrl2 T C 3: 148,858,942 D334G probably damaging Het
Ak9 T G 10: 41,317,830 C57G probably damaging Het
Als2cl A G 9: 110,895,884 K809E probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp11a A G 8: 12,846,099 I223V probably benign Het
Cacna2d3 A T 14: 28,908,321 V1022E probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Cd37 A G 7: 45,237,174 C85R probably damaging Het
Ces1g T C 8: 93,337,136 S7G probably benign Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnbd2 A G 2: 156,375,574 E661G possibly damaging Het
Col6a3 A T 1: 90,822,341 F257Y probably damaging Het
Cpt1b T C 15: 89,424,834 Y55C possibly damaging Het
Csmd1 A G 8: 15,926,611 V2869A probably benign Het
Dnah11 T C 12: 118,179,747 E387G probably benign Het
Eny2 T A 15: 44,429,553 probably null Het
Fbxo10 G T 4: 45,043,857 H655Q probably benign Het
Gm13089 T C 4: 143,697,316 Y301C possibly damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gpx2 C T 12: 76,795,294 G28S probably damaging Het
H2-Q5 G T 17: 35,394,942 A156S probably benign Het
Hoxd4 A G 2: 74,728,463 D210G possibly damaging Het
Hoxd9 A G 2: 74,698,822 Q256R probably damaging Het
Macf1 A G 4: 123,452,292 V2571A probably damaging Het
Mtus1 A G 8: 41,084,037 V214A possibly damaging Het
Myh1 C T 11: 67,220,967 A1716V probably benign Het
Nbeal1 A G 1: 60,222,128 D249G probably damaging Het
Nup54 TCTGCTGCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTGCTGCTG 5: 92,430,804 probably benign Het
Olfr1141 C T 2: 87,753,352 V214I probably benign Het
Olfr1232 A T 2: 89,325,333 N282K probably damaging Het
Olfr1353 T G 10: 78,970,140 L164V probably damaging Het
Olfr1418 G T 19: 11,855,784 H56Q probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pwwp2a A G 11: 43,704,596 D196G probably benign Het
Rarg A T 15: 102,241,892 C93S possibly damaging Het
Rcc1 T C 4: 132,337,762 D150G possibly damaging Het
Ripk2 A G 4: 16,163,330 Y23H probably damaging Het
Rragc A G 4: 123,917,547 Y5C possibly damaging Het
Rubcnl G A 14: 75,031,929 G9D probably damaging Het
Sephs2 A T 7: 127,272,901 V340E probably damaging Het
Slc22a3 C T 17: 12,458,551 M243I probably benign Het
Slco6c1 A G 1: 97,072,793 probably null Het
Sncaip T G 18: 52,906,894 I308R probably damaging Het
Tanc1 G A 2: 59,844,022 E1817K possibly damaging Het
Usp4 C A 9: 108,370,955 Q395K probably damaging Het
Usp49 T A 17: 47,673,347 S210T possibly damaging Het
Virma A G 4: 11,505,498 I124M probably damaging Het
Vmn1r234 G A 17: 21,229,327 V168I probably benign Het
Vnn3 T A 10: 23,856,289 C146S probably damaging Het
Ylpm1 A G 12: 85,042,179 D1234G probably damaging Het
Zfp617 T A 8: 71,933,254 V476E probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AGCAGAAGCCAACTGTTTAGG -3'
(R):5'- TCTGACAAGTGATTGCAGGG -3'

Sequencing Primer
(F):5'- TTAGAGATAAGATCCTCACGTCAC -3'
(R):5'- ATTGCAGGGAGGTGCTTACAC -3'
Posted On 2018-02-27