Incidental Mutation 'R6198:Olfr344'
ID503016
Institutional Source Beutler Lab
Gene Symbol Olfr344
Ensembl Gene ENSMUSG00000096822
Gene Nameolfactory receptor 344
SynonymsGA_x6K02T2NLDC-33262744-33263673, MOR136-12
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36566662-36576178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36568951 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 118 (M118V)
Ref Sequence ENSEMBL: ENSMUSP00000151202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075474] [ENSMUST00000215879]
Predicted Effect probably damaging
Transcript: ENSMUST00000075474
AA Change: M118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074919
Gene: ENSMUSG00000096822
AA Change: M118V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215879
AA Change: M118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Olfr344
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr344 APN 2 36568826 missense probably damaging 1.00
IGL01450:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01452:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01458:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01466:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01470:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01476:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01477:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01478:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01480:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01481:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01487:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01522:Olfr344 APN 2 36569221 missense probably benign 0.00
IGL02141:Olfr344 APN 2 36568808 missense probably damaging 1.00
IGL02510:Olfr344 APN 2 36568681 missense possibly damaging 0.87
IGL02896:Olfr344 APN 2 36569205 missense possibly damaging 0.88
IGL03032:Olfr344 APN 2 36568704 nonsense probably null
R0081:Olfr344 UTSW 2 36568881 nonsense probably null
R0581:Olfr344 UTSW 2 36568822 missense probably damaging 1.00
R0611:Olfr344 UTSW 2 36569556 unclassified probably null
R1503:Olfr344 UTSW 2 36568873 missense probably damaging 1.00
R1844:Olfr344 UTSW 2 36568777 missense probably damaging 1.00
R2320:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
R4088:Olfr344 UTSW 2 36569018 missense probably damaging 1.00
R5243:Olfr344 UTSW 2 36568643 missense probably damaging 1.00
R5747:Olfr344 UTSW 2 36568967 missense probably damaging 0.98
R5948:Olfr344 UTSW 2 36569351 missense probably damaging 1.00
R6115:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6158:Olfr344 UTSW 2 36569116 missense probably benign 0.03
R6531:Olfr344 UTSW 2 36569341 missense probably damaging 1.00
R7075:Olfr344 UTSW 2 36569180 missense probably benign 0.01
R7193:Olfr344 UTSW 2 36569236 missense probably benign 0.06
R7329:Olfr344 UTSW 2 36568696 missense probably benign
R7659:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAACCTGCTCATCATCCTGC -3'
(R):5'- CTGGACAGCTTCAGCAAAGTAG -3'

Sequencing Primer
(F):5'- TCATCAGGCTGGACCCTCAC -3'
(R):5'- CTTCAGCAAAGTAGAGAGGTCAC -3'
Posted On2018-02-27