Incidental Mutation 'R6198:Gm14403'
ID503019
Institutional Source Beutler Lab
Gene Symbol Gm14403
Ensembl Gene ENSMUSG00000094786
Gene Namepredicted gene 14403
Synonyms
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6198 (G1)
Quality Score134.467
Status Validated
Chromosome2
Chromosomal Location177498215-177509763 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AAACCCTA to AA at 177509655 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108940] [ENSMUST00000108947]
Predicted Effect probably benign
Transcript: ENSMUST00000108940
SMART Domains Protein: ENSMUSP00000104568
Gene: ENSMUSG00000094786

DomainStartEndE-ValueType
internal_repeat_1 1 73 1.34e-11 PROSPERO
internal_repeat_1 169 241 1.34e-11 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000108947
SMART Domains Protein: ENSMUSP00000104575
Gene: ENSMUSG00000094786

DomainStartEndE-ValueType
KRAB 4 66 4.86e-13 SMART
ZnF_C2H2 76 97 2.31e2 SMART
ZnF_C2H2 103 125 1.2e-3 SMART
ZnF_C2H2 131 153 1.18e-2 SMART
ZnF_C2H2 159 179 4.57e0 SMART
ZnF_C2H2 187 209 5.59e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 1.18e-2 SMART
ZnF_C2H2 271 293 8.6e-5 SMART
ZnF_C2H2 299 321 3.16e-3 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142549
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Gm14403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Gm14403 APN 2 177507256 missense probably damaging 0.99
IGL02660:Gm14403 APN 2 177509464 missense probably damaging 1.00
R0492:Gm14403 UTSW 2 177508566 missense probably benign 0.09
R0932:Gm14403 UTSW 2 177507017 missense probably benign 0.01
R0975:Gm14403 UTSW 2 177509424 missense probably damaging 1.00
R1468:Gm14403 UTSW 2 177507231 splice site probably benign
R1853:Gm14403 UTSW 2 177509139 missense probably damaging 1.00
R3011:Gm14403 UTSW 2 177508993 missense probably benign
R3803:Gm14403 UTSW 2 177508776 missense probably benign 0.04
R4589:Gm14403 UTSW 2 177508635 missense probably benign 0.29
R4805:Gm14403 UTSW 2 177508699 missense probably damaging 0.97
R5085:Gm14403 UTSW 2 177508489 missense probably benign 0.04
R5311:Gm14403 UTSW 2 177509655 unclassified probably benign
R5425:Gm14403 UTSW 2 177509655 unclassified probably benign
R5643:Gm14403 UTSW 2 177507261 missense possibly damaging 0.87
R5644:Gm14403 UTSW 2 177507261 missense possibly damaging 0.87
R5739:Gm14403 UTSW 2 177509247 missense probably damaging 1.00
R5982:Gm14403 UTSW 2 177508552 missense probably damaging 0.98
R6197:Gm14403 UTSW 2 177509655 unclassified probably benign
R6892:Gm14403 UTSW 2 177509247 missense probably damaging 1.00
R7090:Gm14403 UTSW 2 177509321 missense possibly damaging 0.87
R7168:Gm14403 UTSW 2 177509525 missense probably damaging 0.96
R7510:Gm14403 UTSW 2 177508610 missense probably benign 0.01
R7623:Gm14403 UTSW 2 177508612 missense probably benign
R8049:Gm14403 UTSW 2 177508518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTCATCTCCGAAAACATAACTG -3'
(R):5'- ATTTAGAGGCCAATGCTTTGTG -3'

Sequencing Primer
(F):5'- ACATAACTGAACACATACAGGAGAG -3'
(R):5'- CCAATGCTTTGTGAAAAAGGTG -3'
Posted On2018-02-27