Incidental Mutation 'R6198:Lrrc47'
ID503030
Institutional Source Beutler Lab
Gene Symbol Lrrc47
Ensembl Gene ENSMUSG00000029028
Gene Nameleucine rich repeat containing 47
Synonyms
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154011731-154021513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154015672 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 235 (N235I)
Ref Sequence ENSEMBL: ENSMUSP00000133124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030894] [ENSMUST00000143047] [ENSMUST00000169622] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably damaging
Transcript: ENSMUST00000030894
AA Change: N213I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030894
Gene: ENSMUSG00000029028
AA Change: N213I

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 10 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
LRR_TYP 100 123 2.61e-4 SMART
LRR_TYP 130 153 2.12e-4 SMART
LRR 155 177 3.75e0 SMART
LRR 180 202 9.77e1 SMART
LRR_TYP 203 226 2.27e-4 SMART
low complexity region 261 272 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
B3_4 331 507 8.94e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142794
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163672
Predicted Effect probably benign
Transcript: ENSMUST00000167947
SMART Domains Protein: ENSMUSP00000131382
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
Pfam:B3_4 1 54 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169622
AA Change: N235I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133124
Gene: ENSMUSG00000029028
AA Change: N235I

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
low complexity region 32 58 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
LRR_TYP 122 145 2.61e-4 SMART
LRR_TYP 152 175 2.12e-4 SMART
LRR 177 199 3.75e0 SMART
LRR 202 224 9.77e1 SMART
LRR_TYP 225 248 2.27e-4 SMART
low complexity region 283 294 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
B3_4 353 529 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Lrrc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc47 APN 4 154016014 missense probably benign 0.01
IGL02614:Lrrc47 APN 4 154018935 unclassified probably null
IGL03001:Lrrc47 APN 4 154015993 missense probably damaging 0.99
R0372:Lrrc47 UTSW 4 154019632 missense probably benign 0.00
R0433:Lrrc47 UTSW 4 154018365 unclassified probably benign
R0720:Lrrc47 UTSW 4 154019887 intron probably null
R1163:Lrrc47 UTSW 4 154011817 start codon destroyed probably null
R2078:Lrrc47 UTSW 4 154019431 missense probably damaging 1.00
R2103:Lrrc47 UTSW 4 154015893 missense probably damaging 1.00
R5105:Lrrc47 UTSW 4 154012216 missense probably damaging 1.00
R5109:Lrrc47 UTSW 4 154017476 missense probably damaging 0.99
R5687:Lrrc47 UTSW 4 154015683 missense probably benign 0.10
R5885:Lrrc47 UTSW 4 154015972 missense possibly damaging 0.75
R6384:Lrrc47 UTSW 4 154015860 missense probably benign 0.00
R7040:Lrrc47 UTSW 4 154020452 makesense probably null
R7680:Lrrc47 UTSW 4 154016101 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCTCTGTGAACCAAGGAG -3'
(R):5'- AGACCTTGAGCATCAGCCTG -3'

Sequencing Primer
(F):5'- CTGTGAACCAAGGAGGGGGAG -3'
(R):5'- AGCCTGGCTGAGTCTGCTAC -3'
Posted On2018-02-27