Mutagenetix > Incidental Mutation

Incidental Mutation 'R6198:Nphs1'

503039

Institutional Source

Beutler Lab

Gene Symbol

Nphs1

Ensembl Gene

ENSMUSG00000006649

Gene Name

nephrosis 1, nephrin

Synonyms

nephrin

MMRRC Submission

044338-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6198 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30458315-30487223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30467915 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 756 (I756T)

Ref Sequence

ENSEMBL: ENSMUSP00000006825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]

AlphaFold

Q9QZS7

Predicted Effect

probably damaging
Transcript: ENSMUST00000006825
AA Change: I756T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: I756T

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
IG	52	146	1.38e-6	SMART
Pfam:C2-set_2	152	242	4.1e-20	PFAM
IG	264	351	9.86e-3	SMART
IG_like	360	452	2.73e1	SMART
IG	464	556	2.99e-2	SMART
IG_like	572	644	8.9e-1	SMART
IG	667	751	1.32e-3	SMART
IG	760	849	7.3e-6	SMART
IGc2	868	941	5.4e-9	SMART
FN3	955	1036	1.01e-11	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126297
AA Change: I742T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: I742T

Domain	Start	End	E-Value	Type
IG	38	132	1.38e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152625

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,850		probably null	Het
1700061G19Rik	A	G	17: 56,882,679	S265G	probably damaging	Het
2610318N02Rik	A	G	16: 17,118,369	S164P	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adam19	A	C	11: 46,121,502	N275T	probably damaging	Het
Adgrg7	T	A	16: 56,777,193	T84S	possibly damaging	Het
Asl	C	T	5: 130,018,916	V70I	probably benign	Het
Atp2c1	A	G	9: 105,521,072	S26P	probably benign	Het
Bcas3	A	T	11: 85,509,435	D410V	probably damaging	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ccdc15	A	C	9: 37,314,285		probably null	Het
Cfh	A	G	1: 140,105,440	S789P	probably damaging	Het
Cltc	T	C	11: 86,720,362	N561S	probably benign	Het
Cnst	A	G	1: 179,592,865	Q187R	probably damaging	Het
Csmd3	T	C	15: 48,313,877	T422A	probably benign	Het
Cyp2c55	A	T	19: 39,007,121	R26*	probably null	Het
Dgkb	A	T	12: 38,173,823	M414L	probably benign	Het
Dgkd	A	G	1: 87,924,208	D444G	probably damaging	Het
Dnmt3c	T	C	2: 153,720,009	V544A	noncoding transcript	Het
Dus3l	A	T	17: 56,767,858	T327S	possibly damaging	Het
Elf2	A	T	3: 51,277,249	L5Q	probably damaging	Het
Fam69b	A	G	2: 26,635,698	K215E	probably damaging	Het
Fxyd6	A	G	9: 45,390,670	Y30C	probably damaging	Het
Gcc2	A	T	10: 58,292,590	T1375S	probably benign	Het
Git2	A	T	5: 114,745,495	Y393*	probably null	Het
Gm14403	AAACCCTA	AA	2: 177,509,655		probably benign	Het
Gm9573	T	A	17: 35,620,916		probably benign	Het
Golgb1	T	C	16: 36,893,395	L246P	probably damaging	Het
Grp	G	T	18: 65,879,986	Q74H	possibly damaging	Het
Ifi203	A	T	1: 173,924,082	M391K	probably damaging	Het
Itih2	A	G	2: 10,098,541	Y712H	probably benign	Het
Kdm5a	T	A	6: 120,438,997	V1626E	probably benign	Het
Klhl40	A	G	9: 121,778,767	Y331C	probably damaging	Het
Kprp	T	A	3: 92,824,687	Y352F	probably damaging	Het
Lama2	G	T	10: 27,188,022	H1286Q	probably damaging	Het
Lgi4	T	A	7: 31,069,122		probably null	Het
Lrrc47	A	T	4: 154,015,672	N235I	probably damaging	Het
Lrrc74b	T	A	16: 17,548,786	I308F	probably damaging	Het
Map7d1	T	A	4: 126,241,843	K135M	probably damaging	Het
March5	A	G	19: 37,210,741	R36G	probably damaging	Het
Mtx3	C	A	13: 92,852,851	P299Q	probably benign	Het
Ncapd2	C	A	6: 125,179,323	E500*	probably null	Het
Nckap5l	T	C	15: 99,425,988	K878R	probably damaging	Het
Olfm4	T	G	14: 80,000,373	S17A	probably benign	Het
Olfr1270	A	T	2: 90,149,438	D189E	probably damaging	Het
Olfr344	A	G	2: 36,568,951	M118V	probably damaging	Het
Pak1ip1	G	T	13: 41,001,410	Q27H	probably benign	Het
Piezo2	A	T	18: 63,157,210	C159*	probably null	Het
Pkn2	G	T	3: 142,810,404	T538K	probably benign	Het
Ppp3cc	A	T	14: 70,247,611	M198K	probably benign	Het
Rrm1	T	G	7: 102,446,729		probably null	Het
Setd3	T	C	12: 108,165,168	K7E	possibly damaging	Het
Shc1	A	G	3: 89,422,107	K86R	probably benign	Het
Slc16a7	T	C	10: 125,228,215	T418A	probably benign	Het
Spocd1	C	T	4: 129,955,415	P676S	probably damaging	Het
Spp1	A	G	5: 104,439,508		probably null	Het
Syne1	A	G	10: 5,302,269	Y2462H	probably damaging	Het
Tiam2	T	C	17: 3,414,121	S42P	probably benign	Het
Tmem63b	C	T	17: 45,661,516	V722I	probably benign	Het
Ubqln1	A	G	13: 58,196,590	S130P	probably benign	Het
Usp34	G	T	11: 23,484,127	L3215F	probably damaging	Het
Uvssa	A	G	5: 33,409,510	Y517C	probably damaging	Het
Vps13d	A	T	4: 145,148,990	F1649Y	probably benign	Het
Zfp236	A	G	18: 82,657,153	S405P	probably damaging	Het
Zfp9	T	C	6: 118,477,321	M1V	probably null	Het
Zfp946	A	T	17: 22,454,915	S217C	probably damaging	Het
Zfp970	T	A	2: 177,475,460	C276S	probably damaging	Het
Zswim5	T	A	4: 116,878,007	F183Y	probably benign	Het

Other mutations in Nphs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Nphs1	APN	7	30482551	missense	possibly damaging	0.77
IGL00927:Nphs1	APN	7	30460739	unclassified	probably benign
IGL00976:Nphs1	APN	7	30460685	missense	possibly damaging	0.78
IGL01397:Nphs1	APN	7	30486664	missense	probably benign	0.01
IGL01465:Nphs1	APN	7	30486714	makesense	probably null
IGL01889:Nphs1	APN	7	30460511	missense	probably damaging	1.00
IGL02383:Nphs1	APN	7	30481635	splice site	probably benign
R0020:Nphs1	UTSW	7	30463208	missense	probably benign	0.01
R0485:Nphs1	UTSW	7	30467515	missense	probably benign
R1024:Nphs1	UTSW	7	30474277	missense	probably damaging	1.00
R1115:Nphs1	UTSW	7	30481378	splice site	probably benign
R1144:Nphs1	UTSW	7	30481678	splice site	probably benign
R1289:Nphs1	UTSW	7	30471178	missense	probably damaging	1.00
R1317:Nphs1	UTSW	7	30481831	splice site	probably benign
R1617:Nphs1	UTSW	7	30482531	missense	probably benign
R1756:Nphs1	UTSW	7	30461534	missense	probably benign	0.00
R1937:Nphs1	UTSW	7	30474373	missense	probably damaging	1.00
R2144:Nphs1	UTSW	7	30460970	missense	probably benign	0.13
R2256:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2257:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2277:Nphs1	UTSW	7	30467564	nonsense	probably null
R3104:Nphs1	UTSW	7	30467540	nonsense	probably null
R3106:Nphs1	UTSW	7	30467540	nonsense	probably null
R3151:Nphs1	UTSW	7	30460240	missense	probably benign
R3765:Nphs1	UTSW	7	30471210	missense	probably damaging	0.98
R4078:Nphs1	UTSW	7	30467520	nonsense	probably null
R4397:Nphs1	UTSW	7	30481965	splice site	probably null
R4635:Nphs1	UTSW	7	30468007	missense	probably benign	0.39
R4650:Nphs1	UTSW	7	30482470	missense	probably benign	0.21
R4811:Nphs1	UTSW	7	30460429	missense	probably damaging	1.00
R4850:Nphs1	UTSW	7	30463232	missense	possibly damaging	0.78
R5272:Nphs1	UTSW	7	30481642	missense	possibly damaging	0.86
R5327:Nphs1	UTSW	7	30463825	missense	probably benign	0.00
R5681:Nphs1	UTSW	7	30486625	missense	probably benign	0.00
R5865:Nphs1	UTSW	7	30474385	missense	probably damaging	1.00
R5975:Nphs1	UTSW	7	30466115	missense	possibly damaging	0.82
R6186:Nphs1	UTSW	7	30465634	missense	probably damaging	0.98
R6353:Nphs1	UTSW	7	30474544	missense	probably damaging	0.99
R7405:Nphs1	UTSW	7	30462828	missense	possibly damaging	0.46
R7647:Nphs1	UTSW	7	30481965	splice site	probably null
R7767:Nphs1	UTSW	7	30463308	missense	probably damaging	1.00
R8132:Nphs1	UTSW	7	30482053	missense	probably benign	0.02
R8485:Nphs1	UTSW	7	30466173	missense	probably damaging	0.98
R8678:Nphs1	UTSW	7	30463859	missense	probably damaging	1.00
R8890:Nphs1	UTSW	7	30462655	missense	probably damaging	1.00
R8946:Nphs1	UTSW	7	30463200	missense	probably damaging	1.00
R9133:Nphs1	UTSW	7	30460667	nonsense	probably null
R9159:Nphs1	UTSW	7	30465601	missense	possibly damaging	0.93
R9347:Nphs1	UTSW	7	30471169	missense	probably damaging	1.00
R9547:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9548:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9607:Nphs1	UTSW	7	30463587	missense	probably damaging	1.00
R9626:Nphs1	UTSW	7	30467566	missense	probably benign	0.16
R9720:Nphs1	UTSW	7	30466074	missense	possibly damaging	0.83
R9733:Nphs1	UTSW	7	30467530	missense	probably damaging	1.00
X0028:Nphs1	UTSW	7	30467504	missense	probably null	0.01
Z1177:Nphs1	UTSW	7	30470903	missense	probably damaging	1.00
Z1186:Nphs1	UTSW	7	30460350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCACAGAGGCACAACGATG -3'
(R):5'- CACACATGGCTTCACACAGTG -3'

Sequencing Primer
(F):5'- CAACGATGAAGACAGGCTTATTATC -3'
(R):5'- TCCACTTCCAAGGCGCTAG -3'

Posted On

2018-02-27