Incidental Mutation 'R6198:Slc16a7'
ID 503049
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, 9030411M13Rik, D630004K10Rik, MCT2
MMRRC Submission 044338-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6198 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 125055139-125225334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125064084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 418 (T418A)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably benign
Transcript: ENSMUST00000063318
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105257
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210780
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211781
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,210,499 (GRCm39) probably null Het
2610318N02Rik A G 16: 16,936,233 (GRCm39) S164P probably damaging Het
Acsbg3 A G 17: 57,189,679 (GRCm39) S265G probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adam19 A C 11: 46,012,329 (GRCm39) N275T probably damaging Het
Adgrg7 T A 16: 56,597,556 (GRCm39) T84S possibly damaging Het
Asl C T 5: 130,047,757 (GRCm39) V70I probably benign Het
Atp2c1 A G 9: 105,398,271 (GRCm39) S26P probably benign Het
Bcas3 A T 11: 85,400,261 (GRCm39) D410V probably damaging Het
Cc2d1b C T 4: 108,490,422 (GRCm39) R825W probably damaging Het
Ccdc15 A C 9: 37,225,581 (GRCm39) probably null Het
Cfh A G 1: 140,033,178 (GRCm39) S789P probably damaging Het
Cltc T C 11: 86,611,188 (GRCm39) N561S probably benign Het
Cnst A G 1: 179,420,430 (GRCm39) Q187R probably damaging Het
Csmd3 T C 15: 48,177,273 (GRCm39) T422A probably benign Het
Cyp2c55 A T 19: 38,995,565 (GRCm39) R26* probably null Het
Dgkb A T 12: 38,223,822 (GRCm39) M414L probably benign Het
Dgkd A G 1: 87,851,930 (GRCm39) D444G probably damaging Het
Dipk1b A G 2: 26,525,710 (GRCm39) K215E probably damaging Het
Dnmt3c T C 2: 153,561,929 (GRCm39) V544A noncoding transcript Het
Dus3l A T 17: 57,074,858 (GRCm39) T327S possibly damaging Het
Elf2 A T 3: 51,184,670 (GRCm39) L5Q probably damaging Het
Fxyd6 A G 9: 45,301,968 (GRCm39) Y30C probably damaging Het
Gcc2 A T 10: 58,128,412 (GRCm39) T1375S probably benign Het
Git2 A T 5: 114,883,556 (GRCm39) Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,201,448 (GRCm39) probably benign Het
Golgb1 T C 16: 36,713,757 (GRCm39) L246P probably damaging Het
Grp G T 18: 66,013,057 (GRCm39) Q74H possibly damaging Het
Ifi203 A T 1: 173,751,648 (GRCm39) M391K probably damaging Het
Itih2 A G 2: 10,103,352 (GRCm39) Y712H probably benign Het
Kdm5a T A 6: 120,415,958 (GRCm39) V1626E probably benign Het
Klhl40 A G 9: 121,607,833 (GRCm39) Y331C probably damaging Het
Kprp T A 3: 92,731,994 (GRCm39) Y352F probably damaging Het
Lama2 G T 10: 27,064,018 (GRCm39) H1286Q probably damaging Het
Lgi4 T A 7: 30,768,547 (GRCm39) probably null Het
Lrrc47 A T 4: 154,100,129 (GRCm39) N235I probably damaging Het
Lrrc74b T A 16: 17,366,650 (GRCm39) I308F probably damaging Het
Map7d1 T A 4: 126,135,636 (GRCm39) K135M probably damaging Het
Marchf5 A G 19: 37,188,140 (GRCm39) R36G probably damaging Het
Mtx3 C A 13: 92,989,359 (GRCm39) P299Q probably benign Het
Muc21 T A 17: 35,931,808 (GRCm39) probably benign Het
Ncapd2 C A 6: 125,156,286 (GRCm39) E500* probably null Het
Nckap5l T C 15: 99,323,869 (GRCm39) K878R probably damaging Het
Nphs1 T C 7: 30,167,340 (GRCm39) I756T probably damaging Het
Olfm4 T G 14: 80,237,813 (GRCm39) S17A probably benign Het
Or1j15 A G 2: 36,458,963 (GRCm39) M118V probably damaging Het
Or4b1 A T 2: 89,979,782 (GRCm39) D189E probably damaging Het
Pak1ip1 G T 13: 41,154,886 (GRCm39) Q27H probably benign Het
Piezo2 A T 18: 63,290,281 (GRCm39) C159* probably null Het
Pkn2 G T 3: 142,516,165 (GRCm39) T538K probably benign Het
Ppp3cc A T 14: 70,485,060 (GRCm39) M198K probably benign Het
Rrm1 T G 7: 102,095,936 (GRCm39) probably null Het
Setd3 T C 12: 108,131,427 (GRCm39) K7E possibly damaging Het
Shc1 A G 3: 89,329,414 (GRCm39) K86R probably benign Het
Spocd1 C T 4: 129,849,208 (GRCm39) P676S probably damaging Het
Spp1 A G 5: 104,587,374 (GRCm39) probably null Het
Syne1 A G 10: 5,252,269 (GRCm39) Y2462H probably damaging Het
Tiam2 T C 17: 3,464,396 (GRCm39) S42P probably benign Het
Tmem63b C T 17: 45,972,442 (GRCm39) V722I probably benign Het
Ubqln1 A G 13: 58,344,404 (GRCm39) S130P probably benign Het
Usp34 G T 11: 23,434,127 (GRCm39) L3215F probably damaging Het
Uvssa A G 5: 33,566,854 (GRCm39) Y517C probably damaging Het
Vps13d A T 4: 144,875,560 (GRCm39) F1649Y probably benign Het
Zfp236 A G 18: 82,675,278 (GRCm39) S405P probably damaging Het
Zfp9 T C 6: 118,454,282 (GRCm39) M1V probably null Het
Zfp946 A T 17: 22,673,896 (GRCm39) S217C probably damaging Het
Zfp970 T A 2: 177,167,253 (GRCm39) C276S probably damaging Het
Zswim5 T A 4: 116,735,204 (GRCm39) F183Y probably benign Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125,066,803 (GRCm39) missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125,066,667 (GRCm39) missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125,066,802 (GRCm39) missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125,066,560 (GRCm39) missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125,063,951 (GRCm39) missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125,063,939 (GRCm39) missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125,130,500 (GRCm39) missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125,066,742 (GRCm39) missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125,069,370 (GRCm39) missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125,067,016 (GRCm39) missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125,067,241 (GRCm39) missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125,066,489 (GRCm39) nonsense probably null
R1554:Slc16a7 UTSW 10 125,066,791 (GRCm39) missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125,067,067 (GRCm39) missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3546:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3547:Slc16a7 UTSW 10 125,130,569 (GRCm39) nonsense probably null
R3934:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125,066,712 (GRCm39) missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125,064,056 (GRCm39) missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4513:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R4514:Slc16a7 UTSW 10 125,069,308 (GRCm39) splice site probably null
R5157:Slc16a7 UTSW 10 125,069,333 (GRCm39) nonsense probably null
R5247:Slc16a7 UTSW 10 125,067,183 (GRCm39) missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125,130,473 (GRCm39) missense possibly damaging 0.85
R6263:Slc16a7 UTSW 10 125,130,508 (GRCm39) missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125,066,887 (GRCm39) missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125,063,920 (GRCm39) missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125,066,805 (GRCm39) missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125,164,202 (GRCm39) critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125,066,536 (GRCm39) missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125,066,880 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATTCGGCGATGAGACTTG -3'
(R):5'- AGGTAGGACTGGAACTGGTC -3'

Sequencing Primer
(F):5'- CGGCGATGAGACTTGTTAAATATTAC -3'
(R):5'- GGAAGTTTCCCAGGAGCTTC -3'
Posted On 2018-02-27