Incidental Mutation 'R6198:Slc16a7'
ID 503049
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R6198 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125228215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 418 (T418A)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably benign
Transcript: ENSMUST00000063318
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105257
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210780
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211781
AA Change: T418A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125228051 missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125231011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATTCGGCGATGAGACTTG -3'
(R):5'- AGGTAGGACTGGAACTGGTC -3'

Sequencing Primer
(F):5'- CGGCGATGAGACTTGTTAAATATTAC -3'
(R):5'- GGAAGTTTCCCAGGAGCTTC -3'
Posted On 2018-02-27