Incidental Mutation 'R6198:Cltc'
ID503054
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86720362 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 561 (N561S)
Ref Sequence ENSEMBL: ENSMUSP00000050220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect probably benign
Transcript: ENSMUST00000060766
AA Change: N561S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: N561S

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103186
AA Change: N557S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: N557S

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141152
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
Buckey UTSW 11 86720362 missense probably benign 0.01
fuller UTSW 11 86704160 missense possibly damaging 0.79
Geodesic UTSW 11 86733630 missense probably damaging 0.97
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0515:Cltc UTSW 11 86709039 missense probably benign 0.25
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5072:Cltc UTSW 11 86717968 missense possibly damaging 0.86
R5113:Cltc UTSW 11 86722321 missense probably damaging 0.98
R5126:Cltc UTSW 11 86712669 missense probably damaging 1.00
R5177:Cltc UTSW 11 86705163 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
R7621:Cltc UTSW 11 86707486 missense probably benign 0.03
R7637:Cltc UTSW 11 86730332 missense probably damaging 1.00
R7729:Cltc UTSW 11 86721648 missense probably benign
R7769:Cltc UTSW 11 86719493 missense probably damaging 1.00
R7817:Cltc UTSW 11 86725123 missense probably damaging 1.00
R7944:Cltc UTSW 11 86737141 missense probably benign 0.01
R7945:Cltc UTSW 11 86737141 missense probably benign 0.01
R8040:Cltc UTSW 11 86725205 missense probably damaging 1.00
R8105:Cltc UTSW 11 86707612 missense probably damaging 0.98
R8203:Cltc UTSW 11 86704160 missense possibly damaging 0.79
R8297:Cltc UTSW 11 86712631 missense probably damaging 1.00
R8304:Cltc UTSW 11 86725261 missense probably benign 0.01
R8419:Cltc UTSW 11 86707566 missense probably benign 0.01
R8673:Cltc UTSW 11 86757375 start gained probably benign
Z1176:Cltc UTSW 11 86702632 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTGACAACTTGTAAACATTGGCAC -3'
(R):5'- CTGGTAAAACTCATACATGTTCTTTGC -3'

Sequencing Primer
(F):5'- TGACTTCCCTCAGTGACAGAG -3'
(R):5'- GCATTTTAACATGACTTGCATACGTG -3'
Posted On2018-02-27