Incidental Mutation 'R6198:Ubqln1'
ID503058
Institutional Source Beutler Lab
Gene Symbol Ubqln1
Ensembl Gene ENSMUSG00000005312
Gene Nameubiquilin 1
SynonymsXDRP1, Plic-1, Dsk2, DA41, D13Ertd372e, 1110046H03Rik, 1810030E05Rik
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location58176156-58215653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58196590 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000075782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058735] [ENSMUST00000076454]
Predicted Effect probably benign
Transcript: ENSMUST00000058735
AA Change: S130P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050191
Gene: ENSMUSG00000005312
AA Change: S130P

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 428 2.62e-7 SMART
STI1 432 464 3.1e0 SMART
low complexity region 483 499 N/A INTRINSIC
UBA 540 578 1.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076454
AA Change: S130P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075782
Gene: ENSMUSG00000005312
AA Change: S130P

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 420 2.24e-6 SMART
low complexity region 455 471 N/A INTRINSIC
UBA 512 550 1.77e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null animals display impaired degradation of ubiquitinated proteins in the brain, increased ischemia/reperfusion-caused brain injury, and slower functional recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Ubqln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ubqln1 APN 13 58177992 nonsense probably null
IGL01566:Ubqln1 APN 13 58179667 splice site probably null
IGL02160:Ubqln1 APN 13 58192137 missense probably damaging 1.00
IGL03171:Ubqln1 APN 13 58180858 missense probably damaging 1.00
R0140:Ubqln1 UTSW 13 58193289 missense probably damaging 1.00
R1676:Ubqln1 UTSW 13 58179391 missense possibly damaging 0.67
R1712:Ubqln1 UTSW 13 58192081 missense probably damaging 1.00
R4400:Ubqln1 UTSW 13 58193388 missense probably damaging 1.00
R5194:Ubqln1 UTSW 13 58199033 missense probably benign
R5419:Ubqln1 UTSW 13 58183183 missense probably damaging 0.99
R5778:Ubqln1 UTSW 13 58183317 missense probably benign 0.00
R7829:Ubqln1 UTSW 13 58177905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCGCCACTTACTAAAG -3'
(R):5'- ATGGCATTCTGTTTACAAGAGC -3'

Sequencing Primer
(F):5'- GCTCGCCACTTACTAAAGATAAATAC -3'
(R):5'- GGCATTCTGTTTACAAGAGCTTACTC -3'
Posted On2018-02-27