Incidental Mutation 'R6198:Ppp3cc'
ID503060
Institutional Source Beutler Lab
Gene Symbol Ppp3cc
Ensembl Gene ENSMUSG00000022092
Gene Nameprotein phosphatase 3, catalytic subunit, gamma isoform
SynonymsCalnc, PP2BA gamma
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70217865-70289471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70247611 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000077532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078434] [ENSMUST00000228911]
Predicted Effect probably benign
Transcript: ENSMUST00000078434
AA Change: M198K

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077532
Gene: ENSMUSG00000022092
AA Change: M198K

DomainStartEndE-ValueType
PP2Ac 52 343 4e-151 SMART
low complexity region 413 433 N/A INTRINSIC
low complexity region 492 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228265
Predicted Effect probably benign
Transcript: ENSMUST00000228911
AA Change: M198K

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tiam2 T C 17: 3,414,121 S42P probably benign Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Ppp3cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Ppp3cc APN 14 70218252 missense probably damaging 0.99
IGL02182:Ppp3cc APN 14 70225024 missense probably benign 0.21
IGL02272:Ppp3cc APN 14 70236489 missense probably damaging 1.00
IGL03207:Ppp3cc APN 14 70247582 missense probably damaging 1.00
IGL03394:Ppp3cc APN 14 70225028 nonsense probably null
tomap UTSW 14 70240948 missense probably damaging 1.00
R0111:Ppp3cc UTSW 14 70256359 critical splice donor site probably null
R0625:Ppp3cc UTSW 14 70225027 missense probably damaging 0.99
R1368:Ppp3cc UTSW 14 70245862 missense probably damaging 1.00
R1484:Ppp3cc UTSW 14 70240948 missense probably damaging 1.00
R4757:Ppp3cc UTSW 14 70218186 missense possibly damaging 0.94
R7042:Ppp3cc UTSW 14 70225019 missense probably benign 0.14
R7209:Ppp3cc UTSW 14 70267498 missense probably benign 0.00
R7305:Ppp3cc UTSW 14 70240803 missense probably benign
R7406:Ppp3cc UTSW 14 70245938 missense possibly damaging 0.80
R7509:Ppp3cc UTSW 14 70266682 missense probably damaging 1.00
R7623:Ppp3cc UTSW 14 70240945 missense probably benign 0.37
R7814:Ppp3cc UTSW 14 70225015 missense possibly damaging 0.68
RF002:Ppp3cc UTSW 14 70267339 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACAGTGACAAGATTATGAGTCAGTC -3'
(R):5'- AGACTTGCCTGTAACCAGTGG -3'

Sequencing Primer
(F):5'- AGATTATGAGTCAGTCCCGTATTTC -3'
(R):5'- TGTAACCAGTGGCTTCCGAG -3'
Posted On2018-02-27