Incidental Mutation 'R6198:Tiam2'
ID503068
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 044338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6198 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3414121 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 42 (S42P)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: S42P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: S42P

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: S42P

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: S42P

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226905
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,850 probably null Het
1700061G19Rik A G 17: 56,882,679 S265G probably damaging Het
2610318N02Rik A G 16: 17,118,369 S164P probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam19 A C 11: 46,121,502 N275T probably damaging Het
Adgrg7 T A 16: 56,777,193 T84S possibly damaging Het
Asl C T 5: 130,018,916 V70I probably benign Het
Atp2c1 A G 9: 105,521,072 S26P probably benign Het
Bcas3 A T 11: 85,509,435 D410V probably damaging Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ccdc15 A C 9: 37,314,285 probably null Het
Cfh A G 1: 140,105,440 S789P probably damaging Het
Cltc T C 11: 86,720,362 N561S probably benign Het
Cnst A G 1: 179,592,865 Q187R probably damaging Het
Csmd3 T C 15: 48,313,877 T422A probably benign Het
Cyp2c55 A T 19: 39,007,121 R26* probably null Het
Dgkb A T 12: 38,173,823 M414L probably benign Het
Dgkd A G 1: 87,924,208 D444G probably damaging Het
Dnmt3c T C 2: 153,720,009 V544A noncoding transcript Het
Dus3l A T 17: 56,767,858 T327S possibly damaging Het
Elf2 A T 3: 51,277,249 L5Q probably damaging Het
Fam69b A G 2: 26,635,698 K215E probably damaging Het
Fxyd6 A G 9: 45,390,670 Y30C probably damaging Het
Gcc2 A T 10: 58,292,590 T1375S probably benign Het
Git2 A T 5: 114,745,495 Y393* probably null Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm9573 T A 17: 35,620,916 probably benign Het
Golgb1 T C 16: 36,893,395 L246P probably damaging Het
Grp G T 18: 65,879,986 Q74H possibly damaging Het
Ifi203 A T 1: 173,924,082 M391K probably damaging Het
Itih2 A G 2: 10,098,541 Y712H probably benign Het
Kdm5a T A 6: 120,438,997 V1626E probably benign Het
Klhl40 A G 9: 121,778,767 Y331C probably damaging Het
Kprp T A 3: 92,824,687 Y352F probably damaging Het
Lama2 G T 10: 27,188,022 H1286Q probably damaging Het
Lgi4 T A 7: 31,069,122 probably null Het
Lrrc47 A T 4: 154,015,672 N235I probably damaging Het
Lrrc74b T A 16: 17,548,786 I308F probably damaging Het
Map7d1 T A 4: 126,241,843 K135M probably damaging Het
March5 A G 19: 37,210,741 R36G probably damaging Het
Mtx3 C A 13: 92,852,851 P299Q probably benign Het
Ncapd2 C A 6: 125,179,323 E500* probably null Het
Nckap5l T C 15: 99,425,988 K878R probably damaging Het
Nphs1 T C 7: 30,467,915 I756T probably damaging Het
Olfm4 T G 14: 80,000,373 S17A probably benign Het
Olfr1270 A T 2: 90,149,438 D189E probably damaging Het
Olfr344 A G 2: 36,568,951 M118V probably damaging Het
Pak1ip1 G T 13: 41,001,410 Q27H probably benign Het
Piezo2 A T 18: 63,157,210 C159* probably null Het
Pkn2 G T 3: 142,810,404 T538K probably benign Het
Ppp3cc A T 14: 70,247,611 M198K probably benign Het
Rrm1 T G 7: 102,446,729 probably null Het
Setd3 T C 12: 108,165,168 K7E possibly damaging Het
Shc1 A G 3: 89,422,107 K86R probably benign Het
Slc16a7 T C 10: 125,228,215 T418A probably benign Het
Spocd1 C T 4: 129,955,415 P676S probably damaging Het
Spp1 A G 5: 104,439,508 probably null Het
Syne1 A G 10: 5,302,269 Y2462H probably damaging Het
Tmem63b C T 17: 45,661,516 V722I probably benign Het
Ubqln1 A G 13: 58,196,590 S130P probably benign Het
Usp34 G T 11: 23,484,127 L3215F probably damaging Het
Uvssa A G 5: 33,409,510 Y517C probably damaging Het
Vps13d A T 4: 145,148,990 F1649Y probably benign Het
Zfp236 A G 18: 82,657,153 S405P probably damaging Het
Zfp9 T C 6: 118,477,321 M1V probably null Het
Zfp946 A T 17: 22,454,915 S217C probably damaging Het
Zfp970 T A 2: 177,475,460 C276S probably damaging Het
Zswim5 T A 4: 116,878,007 F183Y probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7925:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTAATTTAGACCATGGC -3'
(R):5'- AAGCCATTCTCAGGTAAGAAAGC -3'

Sequencing Primer
(F):5'- GACCATGGCTCATATTGATACAACTG -3'
(R):5'- CTCAGGTAAGAAAGCACCACTGTTG -3'
Posted On2018-02-27