Mutagenetix > Incidental Mutation

Incidental Mutation 'R6198:Piezo2'

503074

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Piezo2, 9030411M15Rik, Fam38b2, Fam38b, 9430028L06Rik

MMRRC Submission

044338-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6198 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63143284-63520254 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 63290281 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 159 (C159*)

Ref Sequence

ENSEMBL: ENSMUSP00000138758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000046860
AA Change: C159*

SMART Domains

Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: C159*

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000047480
AA Change: C159*

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: C159*

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000182166
AA Change: C51*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182177

Predicted Effect

probably null
Transcript: ENSMUST00000183217
AA Change: C159*

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: C159*

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,210,499 (GRCm39)		probably null	Het
2610318N02Rik	A	G	16: 16,936,233 (GRCm39)	S164P	probably damaging	Het
Acsbg3	A	G	17: 57,189,679 (GRCm39)	S265G	probably damaging	Het
Acyp2	C	T	11: 30,456,354 (GRCm39)	E98K	possibly damaging	Het
Adam19	A	C	11: 46,012,329 (GRCm39)	N275T	probably damaging	Het
Adgrg7	T	A	16: 56,597,556 (GRCm39)	T84S	possibly damaging	Het
Asl	C	T	5: 130,047,757 (GRCm39)	V70I	probably benign	Het
Atp2c1	A	G	9: 105,398,271 (GRCm39)	S26P	probably benign	Het
Bcas3	A	T	11: 85,400,261 (GRCm39)	D410V	probably damaging	Het
Cc2d1b	C	T	4: 108,490,422 (GRCm39)	R825W	probably damaging	Het
Ccdc15	A	C	9: 37,225,581 (GRCm39)		probably null	Het
Cfh	A	G	1: 140,033,178 (GRCm39)	S789P	probably damaging	Het
Cltc	T	C	11: 86,611,188 (GRCm39)	N561S	probably benign	Het
Cnst	A	G	1: 179,420,430 (GRCm39)	Q187R	probably damaging	Het
Csmd3	T	C	15: 48,177,273 (GRCm39)	T422A	probably benign	Het
Cyp2c55	A	T	19: 38,995,565 (GRCm39)	R26*	probably null	Het
Dgkb	A	T	12: 38,223,822 (GRCm39)	M414L	probably benign	Het
Dgkd	A	G	1: 87,851,930 (GRCm39)	D444G	probably damaging	Het
Dipk1b	A	G	2: 26,525,710 (GRCm39)	K215E	probably damaging	Het
Dnmt3c	T	C	2: 153,561,929 (GRCm39)	V544A	noncoding transcript	Het
Dus3l	A	T	17: 57,074,858 (GRCm39)	T327S	possibly damaging	Het
Elf2	A	T	3: 51,184,670 (GRCm39)	L5Q	probably damaging	Het
Fxyd6	A	G	9: 45,301,968 (GRCm39)	Y30C	probably damaging	Het
Gcc2	A	T	10: 58,128,412 (GRCm39)	T1375S	probably benign	Het
Git2	A	T	5: 114,883,556 (GRCm39)	Y393*	probably null	Het
Gm14403	AAACCCTA	AA	2: 177,201,448 (GRCm39)		probably benign	Het
Golgb1	T	C	16: 36,713,757 (GRCm39)	L246P	probably damaging	Het
Grp	G	T	18: 66,013,057 (GRCm39)	Q74H	possibly damaging	Het
Ifi203	A	T	1: 173,751,648 (GRCm39)	M391K	probably damaging	Het
Itih2	A	G	2: 10,103,352 (GRCm39)	Y712H	probably benign	Het
Kdm5a	T	A	6: 120,415,958 (GRCm39)	V1626E	probably benign	Het
Klhl40	A	G	9: 121,607,833 (GRCm39)	Y331C	probably damaging	Het
Kprp	T	A	3: 92,731,994 (GRCm39)	Y352F	probably damaging	Het
Lama2	G	T	10: 27,064,018 (GRCm39)	H1286Q	probably damaging	Het
Lgi4	T	A	7: 30,768,547 (GRCm39)		probably null	Het
Lrrc47	A	T	4: 154,100,129 (GRCm39)	N235I	probably damaging	Het
Lrrc74b	T	A	16: 17,366,650 (GRCm39)	I308F	probably damaging	Het
Map7d1	T	A	4: 126,135,636 (GRCm39)	K135M	probably damaging	Het
Marchf5	A	G	19: 37,188,140 (GRCm39)	R36G	probably damaging	Het
Mtx3	C	A	13: 92,989,359 (GRCm39)	P299Q	probably benign	Het
Muc21	T	A	17: 35,931,808 (GRCm39)		probably benign	Het
Ncapd2	C	A	6: 125,156,286 (GRCm39)	E500*	probably null	Het
Nckap5l	T	C	15: 99,323,869 (GRCm39)	K878R	probably damaging	Het
Nphs1	T	C	7: 30,167,340 (GRCm39)	I756T	probably damaging	Het
Olfm4	T	G	14: 80,237,813 (GRCm39)	S17A	probably benign	Het
Or1j15	A	G	2: 36,458,963 (GRCm39)	M118V	probably damaging	Het
Or4b1	A	T	2: 89,979,782 (GRCm39)	D189E	probably damaging	Het
Pak1ip1	G	T	13: 41,154,886 (GRCm39)	Q27H	probably benign	Het
Pkn2	G	T	3: 142,516,165 (GRCm39)	T538K	probably benign	Het
Ppp3cc	A	T	14: 70,485,060 (GRCm39)	M198K	probably benign	Het
Rrm1	T	G	7: 102,095,936 (GRCm39)		probably null	Het
Setd3	T	C	12: 108,131,427 (GRCm39)	K7E	possibly damaging	Het
Shc1	A	G	3: 89,329,414 (GRCm39)	K86R	probably benign	Het
Slc16a7	T	C	10: 125,064,084 (GRCm39)	T418A	probably benign	Het
Spocd1	C	T	4: 129,849,208 (GRCm39)	P676S	probably damaging	Het
Spp1	A	G	5: 104,587,374 (GRCm39)		probably null	Het
Syne1	A	G	10: 5,252,269 (GRCm39)	Y2462H	probably damaging	Het
Tiam2	T	C	17: 3,464,396 (GRCm39)	S42P	probably benign	Het
Tmem63b	C	T	17: 45,972,442 (GRCm39)	V722I	probably benign	Het
Ubqln1	A	G	13: 58,344,404 (GRCm39)	S130P	probably benign	Het
Usp34	G	T	11: 23,434,127 (GRCm39)	L3215F	probably damaging	Het
Uvssa	A	G	5: 33,566,854 (GRCm39)	Y517C	probably damaging	Het
Vps13d	A	T	4: 144,875,560 (GRCm39)	F1649Y	probably benign	Het
Zfp236	A	G	18: 82,675,278 (GRCm39)	S405P	probably damaging	Het
Zfp9	T	C	6: 118,454,282 (GRCm39)	M1V	probably null	Het
Zfp946	A	T	17: 22,673,896 (GRCm39)	S217C	probably damaging	Het
Zfp970	T	A	2: 177,167,253 (GRCm39)	C276S	probably damaging	Het
Zswim5	T	A	4: 116,735,204 (GRCm39)	F183Y	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,250,770 (GRCm39)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,155,531 (GRCm39)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,203,101 (GRCm39)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,257,685 (GRCm39)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,163,463 (GRCm39)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,315,904 (GRCm39)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,160,630 (GRCm39)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,216,241 (GRCm39)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,175,859 (GRCm39)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,225,915 (GRCm39)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,153,705 (GRCm39)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,279,915 (GRCm39)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,205,933 (GRCm39)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,165,995 (GRCm39)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,157,546 (GRCm39)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,207,730 (GRCm39)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,153,704 (GRCm39)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,197,856 (GRCm39)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,257,731 (GRCm39)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,203,146 (GRCm39)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,163,343 (GRCm39)	splice site	probably null
IGL03129:Piezo2	APN	18	63,248,043 (GRCm39)	missense	probably benign
IGL03143:Piezo2	APN	18	63,241,147 (GRCm39)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,144,669 (GRCm39)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,257,677 (GRCm39)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,186,133 (GRCm39)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,174,791 (GRCm39)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,144,609 (GRCm39)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,154,379 (GRCm39)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,160,775 (GRCm39)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
sopranino	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
woodwind	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,519,271 (GRCm39)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,157,540 (GRCm39)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,235,155 (GRCm39)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,157,562 (GRCm39)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,162,132 (GRCm39)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,235,245 (GRCm39)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,157,522 (GRCm39)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,160,615 (GRCm39)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,155,552 (GRCm39)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,155,497 (GRCm39)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,152,329 (GRCm39)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,174,794 (GRCm39)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,216,306 (GRCm39)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,148,873 (GRCm39)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,219,824 (GRCm39)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,154,325 (GRCm39)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,216,202 (GRCm39)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,277,990 (GRCm39)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,215,986 (GRCm39)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,250,743 (GRCm39)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,154,244 (GRCm39)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,257,713 (GRCm39)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,239,355 (GRCm39)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,241,158 (GRCm39)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,165,911 (GRCm39)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,152,415 (GRCm39)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,247,031 (GRCm39)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,211,911 (GRCm39)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,207,733 (GRCm39)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,211,852 (GRCm39)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,277,997 (GRCm39)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,192,815 (GRCm39)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,252,006 (GRCm39)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,214,805 (GRCm39)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,250,791 (GRCm39)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,247,112 (GRCm39)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,239,345 (GRCm39)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,278,143 (GRCm39)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,155,596 (GRCm39)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,378,695 (GRCm39)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,186,106 (GRCm39)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,279,914 (GRCm39)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,157,506 (GRCm39)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,175,903 (GRCm39)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,214,864 (GRCm39)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,214,733 (GRCm39)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,144,767 (GRCm39)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,183,675 (GRCm39)	missense	probably benign
R4181:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,217,911 (GRCm39)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,257,801 (GRCm39)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,235,170 (GRCm39)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,247,134 (GRCm39)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,205,951 (GRCm39)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,219,699 (GRCm39)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,203,034 (GRCm39)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,163,472 (GRCm39)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,278,025 (GRCm39)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,211,862 (GRCm39)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,290,333 (GRCm39)	missense	probably benign
R4961:Piezo2	UTSW	18	63,186,032 (GRCm39)	splice site	probably null
R4968:Piezo2	UTSW	18	63,278,042 (GRCm39)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,207,751 (GRCm39)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,216,184 (GRCm39)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,157,607 (GRCm39)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,207,691 (GRCm39)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,163,480 (GRCm39)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,166,000 (GRCm39)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,197,802 (GRCm39)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,217,811 (GRCm39)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,278,176 (GRCm39)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,160,935 (GRCm39)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,144,792 (GRCm39)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,278,162 (GRCm39)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,250,768 (GRCm39)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,250,767 (GRCm39)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,279,927 (GRCm39)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,160,972 (GRCm39)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,247,005 (GRCm39)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,248,019 (GRCm39)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,145,716 (GRCm39)	missense	probably damaging	1.00
R6255:Piezo2	UTSW	18	63,254,341 (GRCm39)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,250,749 (GRCm39)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,239,364 (GRCm39)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,219,678 (GRCm39)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,174,734 (GRCm39)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,239,342 (GRCm39)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,154,399 (GRCm39)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,154,333 (GRCm39)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,165,960 (GRCm39)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,223,950 (GRCm39)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,166,057 (GRCm39)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,216,032 (GRCm39)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,278,181 (GRCm39)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,257,780 (GRCm39)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,241,101 (GRCm39)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,150,590 (GRCm39)	splice site	probably null
R7395:Piezo2	UTSW	18	63,160,634 (GRCm39)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,157,543 (GRCm39)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,145,794 (GRCm39)	missense	probably benign
R7517:Piezo2	UTSW	18	63,215,996 (GRCm39)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,186,081 (GRCm39)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,175,610 (GRCm39)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,246,947 (GRCm39)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,216,016 (GRCm39)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,216,271 (GRCm39)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,175,882 (GRCm39)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,163,537 (GRCm39)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,208,801 (GRCm39)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,145,857 (GRCm39)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,217,759 (GRCm39)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,224,069 (GRCm39)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,178,611 (GRCm39)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,279,873 (GRCm39)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,225,971 (GRCm39)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,226,086 (GRCm39)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8727:Piezo2	UTSW	18	63,242,956 (GRCm39)	missense	probably benign
R8810:Piezo2	UTSW	18	63,248,034 (GRCm39)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,248,096 (GRCm39)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,225,902 (GRCm39)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,157,537 (GRCm39)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,178,589 (GRCm39)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,178,550 (GRCm39)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,250,815 (GRCm39)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,290,302 (GRCm39)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,154,372 (GRCm39)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,208,868 (GRCm39)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,163,450 (GRCm39)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,208,790 (GRCm39)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,157,637 (GRCm39)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,162,156 (GRCm39)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,235,236 (GRCm39)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,166,033 (GRCm39)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,519,347 (GRCm39)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,280,016 (GRCm39)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,248,108 (GRCm39)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,197,767 (GRCm39)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,160,657 (GRCm39)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,183,681 (GRCm39)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,150,648 (GRCm39)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,203,065 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGGAATCACATGTCAATCACCTG -3'
(R):5'- ACAGATGTGAGATAACTTCCTCCC -3'

Sequencing Primer
(F):5'- TGTGTCCTCATCTACAAGGTG -3'
(R):5'- ATGTGAGATAACTTCCTCCCGTCTTC -3'

Posted On

2018-02-27