Incidental Mutation 'R6199:Olfr1415'
ID503082
Institutional Source Beutler Lab
Gene Symbol Olfr1415
Ensembl Gene ENSMUSG00000057464
Gene Nameolfactory receptor 1415
SynonymsGA_x6K02T2R7CC-81266841-81267776, MOR103-12
MMRRC Submission 044339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location92489101-92496101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92491542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 71 (I71N)
Ref Sequence ENSEMBL: ENSMUSP00000144986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071521] [ENSMUST00000204009] [ENSMUST00000204766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071521
AA Change: I71N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084047
Gene: ENSMUSG00000057464
AA Change: I71N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204009
AA Change: I71N

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145446
Gene: ENSMUSG00000057464
AA Change: I71N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204766
AA Change: I71N

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144986
Gene: ENSMUSG00000057464
AA Change: I71N

DomainStartEndE-ValueType
Blast:CLECT 1 65 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Olfr1415
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Olfr1415 APN 1 92491583 missense probably damaging 1.00
R0538:Olfr1415 UTSW 1 92491333 missense possibly damaging 0.77
R0924:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R0930:Olfr1415 UTSW 1 92491405 missense possibly damaging 0.95
R1025:Olfr1415 UTSW 1 92491723 missense probably benign 0.19
R1201:Olfr1415 UTSW 1 92491153 missense probably benign 0.04
R1413:Olfr1415 UTSW 1 92490888 missense probably damaging 1.00
R1510:Olfr1415 UTSW 1 92491617 missense probably damaging 1.00
R1846:Olfr1415 UTSW 1 92491100 nonsense probably null
R1850:Olfr1415 UTSW 1 92491402 missense possibly damaging 0.89
R1940:Olfr1415 UTSW 1 92491735 missense probably benign 0.14
R2760:Olfr1415 UTSW 1 92491080 missense probably damaging 0.99
R4066:Olfr1415 UTSW 1 92491189 missense probably damaging 1.00
R4837:Olfr1415 UTSW 1 92490975 missense probably benign 0.39
R5310:Olfr1415 UTSW 1 92491036 missense probably damaging 1.00
R5503:Olfr1415 UTSW 1 92491196 missense probably benign 0.07
R5748:Olfr1415 UTSW 1 92491093 missense probably damaging 0.99
R5760:Olfr1415 UTSW 1 92491200 missense possibly damaging 0.95
R5853:Olfr1415 UTSW 1 92491717 missense probably benign 0.00
R5926:Olfr1415 UTSW 1 92491566 missense probably damaging 1.00
R7585:Olfr1415 UTSW 1 92491320 missense probably benign 0.10
R7627:Olfr1415 UTSW 1 92491385 nonsense probably null
R7726:Olfr1415 UTSW 1 92491307 missense probably benign 0.30
R8011:Olfr1415 UTSW 1 92491275 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCATGATGACTTGGTAGCGCAG -3'
(R):5'- GGAGAACATCACCAAGGTCAGC -3'

Sequencing Primer
(F):5'- CAGGGGGTGGCAGATGGC -3'
(R):5'- AGCACCTTCATCCTGCTGGG -3'
Posted On2018-02-27