Incidental Mutation 'R6199:Plaur'
ID503099
Institutional Source Beutler Lab
Gene Symbol Plaur
Ensembl Gene ENSMUSG00000046223
Gene Nameplasminogen activator, urokinase receptor
SynonymsuPAR, Cd87, urokinase-type plasminogen activator receptor, u-PAR
MMRRC Submission 044339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6199 (G1)
Quality Score169.009
Status Validated
Chromosome7
Chromosomal Location24462484-24475968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24465203 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 44 (Q44L)
Ref Sequence ENSEMBL: ENSMUSP00000145632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002284] [ENSMUST00000206514] [ENSMUST00000206935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002284
AA Change: Q44L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002284
Gene: ENSMUSG00000046223
AA Change: Q44L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LU 24 114 1.9e-29 SMART
LU 117 206 2.36e-25 SMART
LU 213 308 1.17e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205877
Predicted Effect possibly damaging
Transcript: ENSMUST00000206514
AA Change: Q44L

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206693
Predicted Effect possibly damaging
Transcript: ENSMUST00000206935
AA Change: Q44L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele exhibit chronic inflammation, macrophage dysfunction, and reduced angiogenesis. Homozygotes for another null allele show neutrophil dysfunction, increased anxiety, loss of GABAergic neurons, myoclonus, and susceptibility to bacterial infection and PTZ -induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Plaur
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1513:Plaur UTSW 7 24472591 missense probably benign 0.00
R4229:Plaur UTSW 7 24466783 missense probably damaging 0.99
R4935:Plaur UTSW 7 24466716 missense possibly damaging 0.70
R6254:Plaur UTSW 7 24466800 missense possibly damaging 0.95
X0020:Plaur UTSW 7 24472709 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGCCTAGATCAGTTTCACAC -3'
(R):5'- GGGTTGCACCAACACTGTAAAC -3'

Sequencing Primer
(F):5'- GCCTAGATCAGTTTCACACCATGG -3'
(R):5'- CGGTCCTTTACAAGATCAACAGGTG -3'
Posted On2018-02-27