Incidental Mutation 'R6199:Ick'
ID503105
Institutional Source Beutler Lab
Gene Symbol Ick
Ensembl Gene ENSMUSG00000009828
Gene Nameintestinal cell kinase
Synonyms2210420N10Rik
MMRRC Submission 044339-MU
Accession Numbers

Genbank: NM_001163780, NM_019987

Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78109192-78172107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78164639 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 531 (V531A)
Ref Sequence ENSEMBL: ENSMUSP00000112961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044551] [ENSMUST00000117330] [ENSMUST00000118869]
Predicted Effect probably benign
Transcript: ENSMUST00000044551
AA Change: V531A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048234
Gene: ENSMUSG00000009828
AA Change: V531A

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117330
AA Change: V531A
SMART Domains Protein: ENSMUSP00000113655
Gene: ENSMUSG00000009828
AA Change: V531A

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118869
AA Change: V531A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112961
Gene: ENSMUSG00000009828
AA Change: V531A

DomainStartEndE-ValueType
S_TKc 4 284 2.7e-102 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 413 422 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142402
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic protein kinases are enzymes that belong to a very extensive family of proteins which share a conserved catalytic core common with both serine/threonine and tyrosine protein kinases. This gene encodes an intestinal serine/threonine kinase harboring a dual phosphorylation site found in mitogen-activating protein (MAP) kinases. The protein localizes to the intestinal crypt region and is thought to be important in intestinal epithelial cell proliferation and differentiation. Alternative splicing has been observed at this locus and two variants, encoding the same isoform, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal primary cilium morphology and Shh signaling during limb digit patterning, peripheral edema, cleft palate, hydrocephalus, polydactyly, delayed skeletal development, and embryonic lethality at late stages of gestation. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted, other(1) Gene trapped(28)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Ick
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ick APN 9 78164539 missense probably benign 0.00
IGL01679:Ick APN 9 78140025 missense possibly damaging 0.94
IGL02525:Ick APN 9 78160393 missense probably benign 0.37
IGL02719:Ick APN 9 78140019 missense probably damaging 0.99
H8930:Ick UTSW 9 78150619 missense possibly damaging 0.92
R0471:Ick UTSW 9 78155517 critical splice donor site probably null
R1626:Ick UTSW 9 78150637 missense probably damaging 1.00
R1824:Ick UTSW 9 78157862 missense probably benign
R2186:Ick UTSW 9 78131487 missense probably benign 0.07
R2872:Ick UTSW 9 78140100 splice site probably null
R2872:Ick UTSW 9 78140100 splice site probably null
R4609:Ick UTSW 9 78167789 utr 3 prime probably benign
R4737:Ick UTSW 9 78150654 missense probably damaging 1.00
R4792:Ick UTSW 9 78153693 missense probably damaging 1.00
R5001:Ick UTSW 9 78131519 missense probably damaging 1.00
R5060:Ick UTSW 9 78153696 missense probably benign 0.01
R5093:Ick UTSW 9 78140021 missense probably benign 0.24
R5393:Ick UTSW 9 78160715 missense probably benign
R6412:Ick UTSW 9 78139976 missense probably damaging 1.00
R7038:Ick UTSW 9 78109202 unclassified probably benign
R7468:Ick UTSW 9 78157939 missense probably benign 0.00
R7660:Ick UTSW 9 78167620 missense probably benign
R7661:Ick UTSW 9 78167620 missense probably benign
R7662:Ick UTSW 9 78167620 missense probably benign
R7666:Ick UTSW 9 78167620 missense probably benign
R7693:Ick UTSW 9 78157726 missense probably benign
X0067:Ick UTSW 9 78155403 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCTCCTGGTCTCCTTATGAC -3'
(R):5'- CCCTAGGGCTGCTACAAAAG -3'

Sequencing Primer
(F):5'- ATCCTTCGTGTAGATGTACCATTG -3'
(R):5'- GCTGCTACAAAAGGGAGAGC -3'
Posted On2018-02-27