Incidental Mutation 'R6199:Adck1'
ID503117
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene NameaarF domain containing kinase 1
Synonyms2610005A10Rik
MMRRC Submission 044339-MU
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location88360554-88461724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88441117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 206 (D206V)
Ref Sequence ENSEMBL: ENSMUSP00000152821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101165
AA Change: D206V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: D206V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166940
AA Change: D206V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: D206V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222124
Predicted Effect possibly damaging
Transcript: ENSMUST00000222695
AA Change: D206V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223538
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tmem2 G A 19: 21,844,822 G1194S probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R6915:Adck1 UTSW 12 88455620 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
R7520:Adck1 UTSW 12 88459205 critical splice donor site probably null
R7562:Adck1 UTSW 12 88368433 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCCATGTGTATTTCACGGGAGA -3'
(R):5'- TGTAGGGACAGCCAGGGT -3'

Sequencing Primer
(F):5'- ACTGGGATCGGAAGTCTCATCTC -3'
(R):5'- GTAGGGCCCAACCGACC -3'
Posted On2018-02-27