Incidental Mutation 'R6199:Tmem2'
ID503128
Institutional Source Beutler Lab
Gene Symbol Tmem2
Ensembl Gene ENSMUSG00000024754
Gene Nametransmembrane protein 2
Synonyms
MMRRC Submission 044339-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R6199 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location21778342-21858327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21844822 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1194 (G1194S)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
Predicted Effect probably benign
Transcript: ENSMUST00000025663
AA Change: G1194S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: G1194S

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096194
AA Change: G1194S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: G1194S

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A T 12: 88,441,117 D206V possibly damaging Het
Ank2 T A 3: 127,004,006 D685V probably damaging Het
Baz2b A G 2: 59,978,675 S77P probably benign Het
C430049E01Rik T C 8: 71,525,465 N83D probably benign Het
Ceacam5 A T 7: 17,714,885 T59S probably benign Het
Ces1e A C 8: 93,217,535 F218L probably damaging Het
Cps1 TGTCCATTGGTC TGTC 1: 67,162,615 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eftud2 A T 11: 102,840,057 V843E probably damaging Het
Fuca2 G T 10: 13,506,039 W232L probably damaging Het
Gdf7 T C 12: 8,298,832 D155G unknown Het
Ggcx G T 6: 72,430,139 V753F possibly damaging Het
Ghrhr A T 6: 55,379,188 T89S probably benign Het
Gpr151 T C 18: 42,578,554 K353R probably benign Het
Gpr75 T C 11: 30,891,527 L144P probably damaging Het
Gsdmc2 A G 15: 63,825,113 I403T probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Ick T C 9: 78,164,639 V531A probably benign Het
Igsf5 C T 16: 96,421,739 S61L possibly damaging Het
Insc A T 7: 114,791,166 probably null Het
Izumo4 G A 10: 80,702,873 G53D probably damaging Het
Ksr1 G A 11: 79,020,441 P693S possibly damaging Het
Lgals4 G A 7: 28,835,892 R27H probably damaging Het
Lpcat2b A G 5: 107,433,305 R167G probably benign Het
Man1a C T 10: 54,014,456 V288I possibly damaging Het
Map2 T G 1: 66,425,478 S1676A probably damaging Het
Mbl1 G T 14: 41,153,615 V9F unknown Het
Mrgprb8 T A 7: 48,389,303 C241S probably benign Het
Mrpl2 T C 17: 46,649,086 L227P probably damaging Het
Mthfd1 T A 12: 76,288,911 V253E probably damaging Het
Mthfd1 A G 12: 76,303,680 H464R probably damaging Het
Mug2 T A 6: 122,047,439 M490K probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Notch1 A G 2: 26,469,899 V1268A probably damaging Het
Olfr1415 A T 1: 92,491,542 I71N possibly damaging Het
Olfr876 C A 9: 37,804,881 probably null Het
Pgm2 A T 4: 99,978,954 I412F probably damaging Het
Plaur A T 7: 24,465,203 Q44L possibly damaging Het
Ppara T C 15: 85,787,233 Y112H probably damaging Het
Ppm1h G A 10: 122,920,739 V430M probably damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prph A G 15: 99,056,832 T35A probably benign Het
Prrc2c C T 1: 162,682,516 G780S probably damaging Het
Ptchd3 T A 11: 121,831,082 N260K probably benign Het
Ptprz1 A G 6: 23,002,471 D1520G probably benign Het
Samd9l T A 6: 3,376,686 I192L probably benign Het
Slc39a10 T C 1: 46,835,833 D103G probably damaging Het
Smndc1 G A 19: 53,383,632 T117M probably benign Het
Tesk2 A G 4: 116,792,170 D159G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r108 A T 17: 20,462,382 N853K probably benign Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Other mutations in Tmem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tmem2 APN 19 21844757 missense possibly damaging 0.77
IGL01528:Tmem2 APN 19 21835545 missense possibly damaging 0.95
IGL01642:Tmem2 APN 19 21823901 missense probably damaging 1.00
IGL01693:Tmem2 APN 19 21801887 missense probably benign 0.00
IGL02437:Tmem2 APN 19 21811978 critical splice donor site probably null
IGL02869:Tmem2 APN 19 21811877 missense probably damaging 0.99
IGL02880:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02904:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02941:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02950:Tmem2 APN 19 21842200 missense probably benign 0.07
IGL03066:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL03120:Tmem2 APN 19 21823843 missense possibly damaging 0.68
R0005:Tmem2 UTSW 19 21812220 missense probably damaging 0.98
R0496:Tmem2 UTSW 19 21797345 missense possibly damaging 0.89
R0557:Tmem2 UTSW 19 21811903 missense probably benign 0.05
R0620:Tmem2 UTSW 19 21817971 missense probably benign
R1271:Tmem2 UTSW 19 21823904 missense possibly damaging 0.92
R1435:Tmem2 UTSW 19 21844706 missense probably benign
R1543:Tmem2 UTSW 19 21812573 missense probably benign 0.03
R1558:Tmem2 UTSW 19 21797982 nonsense probably null
R1658:Tmem2 UTSW 19 21801879 missense probably damaging 1.00
R1744:Tmem2 UTSW 19 21832137 nonsense probably null
R1859:Tmem2 UTSW 19 21847977 missense possibly damaging 0.56
R1943:Tmem2 UTSW 19 21848040 splice site probably null
R2001:Tmem2 UTSW 19 21801987 missense probably benign 0.43
R2021:Tmem2 UTSW 19 21844750 missense possibly damaging 0.91
R2177:Tmem2 UTSW 19 21811785 missense possibly damaging 0.80
R2183:Tmem2 UTSW 19 21823793 missense possibly damaging 0.81
R2921:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2922:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2923:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R3727:Tmem2 UTSW 19 21844711 missense probably benign
R3730:Tmem2 UTSW 19 21826117 missense probably damaging 0.97
R3790:Tmem2 UTSW 19 21807452 missense probably damaging 1.00
R3831:Tmem2 UTSW 19 21847951 missense probably damaging 0.97
R3858:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3859:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3899:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R4096:Tmem2 UTSW 19 21792652 start codon destroyed probably null 0.99
R4206:Tmem2 UTSW 19 21842115 missense probably damaging 1.00
R4480:Tmem2 UTSW 19 21815489 missense probably benign 0.03
R4667:Tmem2 UTSW 19 21797351 missense probably benign 0.00
R4667:Tmem2 UTSW 19 21844781 missense probably benign
R4888:Tmem2 UTSW 19 21856164 missense probably benign 0.00
R4914:Tmem2 UTSW 19 21809289 missense probably benign 0.00
R5030:Tmem2 UTSW 19 21842105 missense probably benign
R5329:Tmem2 UTSW 19 21798329 missense probably benign 0.30
R5977:Tmem2 UTSW 19 21826083 missense probably benign 0.01
R6013:Tmem2 UTSW 19 21832039 missense possibly damaging 0.89
R6049:Tmem2 UTSW 19 21826126 missense probably benign
R6215:Tmem2 UTSW 19 21812387 missense probably benign 0.02
R6273:Tmem2 UTSW 19 21802005 missense probably damaging 1.00
R6429:Tmem2 UTSW 19 21801908 missense probably benign 0.14
R6547:Tmem2 UTSW 19 21844831 missense probably benign 0.01
R6630:Tmem2 UTSW 19 21852229 missense probably damaging 0.99
R6870:Tmem2 UTSW 19 21832123 missense possibly damaging 0.91
R7276:Tmem2 UTSW 19 21835460 missense probably benign 0.14
R7336:Tmem2 UTSW 19 21826145 nonsense probably null
R7363:Tmem2 UTSW 19 21856211 missense probably benign
R7678:Tmem2 UTSW 19 21798116 missense probably damaging 1.00
R7727:Tmem2 UTSW 19 21829957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAACATCAGTTGGCTTGGTTTC -3'
(R):5'- GACTGCTCTGCTTCTTATGAGC -3'

Sequencing Primer
(F):5'- TCTGTATCTCAGAGCCCACAG -3'
(R):5'- GCTCTGCTTCTTATGAGCAACAC -3'
Posted On2018-02-27