Incidental Mutation 'R6200:Tmc1'
ID 503164
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
MMRRC Submission 044340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6200 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 20789590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 749 (R749Q)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect possibly damaging
Transcript: ENSMUST00000039500
AA Change: R749Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: R749Q

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 91% (32/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,090,050 Y54C probably damaging Het
Ash1l A G 3: 89,070,527 H2719R probably damaging Het
Atraid A G 5: 31,052,866 N127D probably damaging Het
Capzb T C 4: 139,280,013 V145A probably benign Het
Cldn17 A C 16: 88,506,571 L90R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Fancc A C 13: 63,360,248 L158V probably damaging Het
Fcamr T C 1: 130,803,190 L60P probably benign Het
G6pd2 C T 5: 61,809,871 R330C probably benign Het
Gm16432 A G 1: 178,111,558 N666D possibly damaging Het
Gm4788 T A 1: 139,754,335 R174S probably damaging Het
Gpr158 A T 2: 21,399,416 N333I probably damaging Het
Herpud2 A G 9: 25,150,834 Y45H probably damaging Het
Icam5 A G 9: 21,038,749 Y868C probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Luzp1 C A 4: 136,541,266 Q267K probably benign Het
Nkpd1 C A 7: 19,524,603 A769E possibly damaging Het
Olfr482 AACTCTGTCACT AACT 7: 108,095,525 probably null Het
Pabpc4l C A 3: 46,446,703 V169L probably damaging Het
Pcdhga7 A G 18: 37,716,082 N381D probably damaging Het
Pcsk1 A T 13: 75,115,255 N372Y possibly damaging Het
Ppp1r21 C T 17: 88,569,185 T475M possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Psd2 G A 18: 36,006,723 probably null Het
Psip1 T C 4: 83,474,373 K100E probably benign Het
Pxdn A G 12: 30,003,112 H1096R probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Slc16a8 C T 15: 79,252,937 G91D probably damaging Het
Slc22a21 A T 11: 53,958,038 I296N probably damaging Het
Smad9 A G 3: 54,789,186 D224G probably benign Het
Tle2 G A 10: 81,588,872 V678M probably damaging Het
Tmco3 T A 8: 13,292,077 probably null Het
Tspoap1 A G 11: 87,761,703 E101G possibly damaging Het
Zfp57 A T 17: 37,010,411 T386S probably benign Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAGATAGATGCTTGGG -3'
(R):5'- AAGCAGCGAATCTGGACCTC -3'

Sequencing Primer
(F):5'- CCTCAGATAGATGCTTGGGAAGATC -3'
(R):5'- GCGAATCTGGACCTCAAAAAG -3'
Posted On 2018-02-27