Mutagenetix > Incidental Mutations

Incidental Mutation 'R6200:Tmc1'

503164

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

044340-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6200 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20789590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 749 (R749Q)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039500
AA Change: R749Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: R749Q

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

91% (32/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,090,050	Y54C	probably damaging	Het
Ash1l	A	G	3: 89,070,527	H2719R	probably damaging	Het
Atraid	A	G	5: 31,052,866	N127D	probably damaging	Het
Capzb	T	C	4: 139,280,013	V145A	probably benign	Het
Cldn17	A	C	16: 88,506,571	L90R	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Fancc	A	C	13: 63,360,248	L158V	probably damaging	Het
Fcamr	T	C	1: 130,803,190	L60P	probably benign	Het
G6pd2	C	T	5: 61,809,871	R330C	probably benign	Het
Gm16432	A	G	1: 178,111,558	N666D	possibly damaging	Het
Gm4788	T	A	1: 139,754,335	R174S	probably damaging	Het
Gpr158	A	T	2: 21,399,416	N333I	probably damaging	Het
Herpud2	A	G	9: 25,150,834	Y45H	probably damaging	Het
Icam5	A	G	9: 21,038,749	Y868C	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Homo
Luzp1	C	A	4: 136,541,266	Q267K	probably benign	Het
Nkpd1	C	A	7: 19,524,603	A769E	possibly damaging	Het
Olfr482	AACTCTGTCACT	AACT	7: 108,095,525		probably null	Het
Pabpc4l	C	A	3: 46,446,703	V169L	probably damaging	Het
Pcdhga7	A	G	18: 37,716,082	N381D	probably damaging	Het
Pcsk1	A	T	13: 75,115,255	N372Y	possibly damaging	Het
Ppp1r21	C	T	17: 88,569,185	T475M	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Psd2	G	A	18: 36,006,723		probably null	Het
Psip1	T	C	4: 83,474,373	K100E	probably benign	Het
Pxdn	A	G	12: 30,003,112	H1096R	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a8	C	T	15: 79,252,937	G91D	probably damaging	Het
Slc22a21	A	T	11: 53,958,038	I296N	probably damaging	Het
Smad9	A	G	3: 54,789,186	D224G	probably benign	Het
Tle2	G	A	10: 81,588,872	V678M	probably damaging	Het
Tmco3	T	A	8: 13,292,077		probably null	Het
Tspoap1	A	G	11: 87,761,703	E101G	possibly damaging	Het
Zfp57	A	T	17: 37,010,411	T386S	probably benign	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTCAGATAGATGCTTGGG -3'
(R):5'- AAGCAGCGAATCTGGACCTC -3'

Sequencing Primer
(F):5'- CCTCAGATAGATGCTTGGGAAGATC -3'
(R):5'- GCGAATCTGGACCTCAAAAAG -3'

Posted On

2018-02-27