Incidental Mutation 'R6207:Calcrl'
ID503172
Institutional Source Beutler Lab
Gene Symbol Calcrl
Ensembl Gene ENSMUSG00000059588
Gene Namecalcitonin receptor-like
SynonymsCRLR
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84330626-84425411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84333530 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 439 (H439R)
Ref Sequence ENSEMBL: ENSMUSP00000097527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074262] [ENSMUST00000099944]
Predicted Effect probably benign
Transcript: ENSMUST00000074262
AA Change: H439R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073875
Gene: ENSMUSG00000059588
AA Change: H439R

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 5.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099944
AA Change: H439R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097527
Gene: ENSMUSG00000059588
AA Change: H439R

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 3.2e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality between E13.5-E14.5, hydrops fetalis and cardiovascular defects such as thin vascular smooth muscle walls and small, disorganized hearts resulting from a decrease in cell proliferation and an increasein apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Calcrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Calcrl APN 2 84370454 missense probably benign 0.05
IGL01395:Calcrl APN 2 84368575 missense probably benign 0.25
IGL01672:Calcrl APN 2 84345070 missense probably damaging 1.00
IGL01738:Calcrl APN 2 84370449 missense probably benign 0.00
IGL01773:Calcrl APN 2 84370443 missense probably benign
IGL02007:Calcrl APN 2 84375324 missense probably benign
IGL02254:Calcrl APN 2 84348208 missense probably damaging 1.00
IGL02887:Calcrl APN 2 84339242 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0485:Calcrl UTSW 2 84370091 missense probably benign 0.01
R1579:Calcrl UTSW 2 84333537 missense probably benign 0.00
R1640:Calcrl UTSW 2 84333677 missense probably damaging 0.98
R1694:Calcrl UTSW 2 84339287 missense probably damaging 1.00
R1731:Calcrl UTSW 2 84345168 critical splice donor site probably null
R1779:Calcrl UTSW 2 84351285 missense probably damaging 1.00
R1992:Calcrl UTSW 2 84370511 missense probably damaging 0.98
R2262:Calcrl UTSW 2 84345173 missense probably damaging 1.00
R2763:Calcrl UTSW 2 84370503 missense probably damaging 0.99
R3903:Calcrl UTSW 2 84368642 splice site probably benign
R4838:Calcrl UTSW 2 84351205 missense probably damaging 0.99
R4901:Calcrl UTSW 2 84333513 missense probably benign 0.00
R4997:Calcrl UTSW 2 84351248 nonsense probably null
R4998:Calcrl UTSW 2 84339314 missense probably damaging 1.00
R5791:Calcrl UTSW 2 84351265 missense probably damaging 1.00
R5887:Calcrl UTSW 2 84370497 missense probably damaging 1.00
R6046:Calcrl UTSW 2 84375314 missense probably benign 0.00
R6959:Calcrl UTSW 2 84370084 missense possibly damaging 0.76
R6972:Calcrl UTSW 2 84368578 missense probably benign
R7522:Calcrl UTSW 2 84373364 missense probably benign
R7653:Calcrl UTSW 2 84345185 nonsense probably null
R7911:Calcrl UTSW 2 84351231 missense probably damaging 1.00
R8082:Calcrl UTSW 2 84370442 missense possibly damaging 0.56
R8110:Calcrl UTSW 2 84339339 missense probably damaging 1.00
R8152:Calcrl UTSW 2 84339249 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGGCTTTCTTCATGGTATTCC -3'
(R):5'- AGAGCAAAAGCTTTTCTGCCAAAC -3'

Sequencing Primer
(F):5'- GGTATTCCAGAAATCCATTTGCTGGC -3'
(R):5'- GAGTATTTTCAGCTCAACTAATGGG -3'
Posted On2018-02-27