Incidental Mutation 'R6207:Snrnp200'
ID503173
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127210735 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 84 (M84K)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056146] [ENSMUST00000103220]
Predicted Effect probably benign
Transcript: ENSMUST00000056146
SMART Domains Protein: ENSMUSP00000061355
Gene: ENSMUSG00000044145

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 1.5e-30 PFAM
Pfam:Pkinase 1 189 2.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103220
AA Change: M84K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: M84K

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150956
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R7916:Snrnp200 UTSW 2 127233059 missense possibly damaging 0.51
R8117:Snrnp200 UTSW 2 127229131 missense probably benign
R8262:Snrnp200 UTSW 2 127227008 missense probably damaging 1.00
R8551:Snrnp200 UTSW 2 127227051 missense probably benign 0.03
R8675:Snrnp200 UTSW 2 127232523 missense possibly damaging 0.94
R8754:Snrnp200 UTSW 2 127226085 missense probably damaging 1.00
R8852:Snrnp200 UTSW 2 127218429 missense probably damaging 0.99
R8899:Snrnp200 UTSW 2 127236597 missense probably damaging 1.00
R8937:Snrnp200 UTSW 2 127226982 missense probably benign 0.04
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTCAAATCACTAAGGTCTGGTAGG -3'
(R):5'- TGACCTGGAACATGTTCACTAC -3'

Sequencing Primer
(F):5'- CACTAAGGTCTGGTAGGAGTTAATC -3'
(R):5'- TGCTCGAATGGTACTGCC -3'
Posted On2018-02-27