Incidental Mutation 'R6207:Pus1'
ID503183
Institutional Source Beutler Lab
Gene Symbol Pus1
Ensembl Gene ENSMUSG00000029507
Gene Namepseudouridine synthase 1
SynonymsMPUS1, A730013B20Rik, mPus1p
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110773667-110780659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110777714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Ref Sequence ENSEMBL: ENSMUSP00000115468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031481] [ENSMUST00000031483] [ENSMUST00000086643] [ENSMUST00000112426] [ENSMUST00000136483] [ENSMUST00000149208] [ENSMUST00000170468]
Predicted Effect probably benign
Transcript: ENSMUST00000031481
AA Change: D80G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031481
Gene: ENSMUSG00000029507
AA Change: D80G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031483
AA Change: D110G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031483
Gene: ENSMUSG00000029507
AA Change: D110G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 191 1.3e-11 PFAM
Pfam:PseudoU_synth_1 231 337 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086643
AA Change: D110G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000083844
Gene: ENSMUSG00000029507
AA Change: D110G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 84 208 1.2e-7 PFAM
Pfam:PseudoU_synth_1 249 355 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112426
SMART Domains Protein: ENSMUSP00000108045
Gene: ENSMUSG00000029507

DomainStartEndE-ValueType
SCOP:d1dj0a1 48 116 1e-12 SMART
Pfam:PseudoU_synth_1 155 261 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132267
Predicted Effect probably benign
Transcript: ENSMUST00000136483
AA Change: D80G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115143
Gene: ENSMUSG00000029507
AA Change: D80G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 147 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149208
AA Change: D80G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115468
Gene: ENSMUSG00000029507
AA Change: D80G

DomainStartEndE-ValueType
PDB:4J37|A 37 162 3e-57 PDB
SCOP:d1dj0a1 48 162 3e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170468
AA Change: D80G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130814
Gene: ENSMUSG00000029507
AA Change: D80G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 54 161 4.7e-13 PFAM
Pfam:PseudoU_synth_1 201 307 2.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181141
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudouridine synthase that converts uridine to pseudouridine once it has been incorporated into an RNA molecule. The encoded enzyme may play an essential role in tRNA function and in stabilizing the secondary and tertiary structure of many RNAs. A mutation in this gene has been linked to mitochondrial myopathy and sideroblastic anemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slow postnatal weight gain, impaired exercise endurance, and alterations in muscle metabolism related to mitochondrial content and oxidative capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Pus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Pus1 UTSW 5 110774854 missense probably benign 0.09
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0242:Pus1 UTSW 5 110779798 missense probably benign 0.02
R0486:Pus1 UTSW 5 110779730 missense probably damaging 1.00
R1922:Pus1 UTSW 5 110777639 missense probably damaging 1.00
R2305:Pus1 UTSW 5 110774960 missense probably benign 0.08
R4528:Pus1 UTSW 5 110774730 missense probably damaging 1.00
R4609:Pus1 UTSW 5 110780318 start codon destroyed probably null 0.06
R4846:Pus1 UTSW 5 110779930 intron probably benign
R5720:Pus1 UTSW 5 110777718 missense probably damaging 1.00
R7123:Pus1 UTSW 5 110773932 makesense probably null
R7449:Pus1 UTSW 5 110774586 missense probably damaging 1.00
R7827:Pus1 UTSW 5 110779716 missense probably damaging 1.00
RF016:Pus1 UTSW 5 110776558 missense not run
Predicted Primers PCR Primer
(F):5'- ATCCCTTCTGACAGGTGGAC -3'
(R):5'- CTTGGACCTAGTCTCTATTGTGAGG -3'

Sequencing Primer
(F):5'- AGGTGGACCCTGAGACCATG -3'
(R):5'- ACGTGGTGTCTGACCTCAC -3'
Posted On2018-02-27