Incidental Mutation 'R6207:Olfr310'
ID503195
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86269760 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 10 (F10V)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: F10V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: F10V

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: F10V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTAAAATGGACAGATTCCTGAG -3'
(R):5'- ACTGGACAGATAGGTATAACTCTGTG -3'

Sequencing Primer
(F):5'- TTCCTGAGGAAGAAGTACATGG -3'
(R):5'- ATTAAGTTATTCCTTGTCC -3'
Posted On2018-02-27