Incidental Mutation 'R6207:Unc13c'
ID503205
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73758628 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1037 (K1037E)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075245
AA Change: K1037E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: K1037E

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184666
AA Change: K1037E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: K1037E

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Myb A G 10: 21,145,322 S403P probably benign Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATAACGAATGTGTTAGTGCTAGGC -3'
(R):5'- AGACAAAGACCTAGAGCCTTGG -3'

Sequencing Primer
(F):5'- GGCATATTCTGGCCCTGG -3'
(R):5'- AAGACCTAGAGCCTTGGATCTTC -3'
Posted On2018-02-27