Incidental Mutation 'R6207:Myb'
ID503206
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission 044341-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6207 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21145322 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 403 (S403P)
Ref Sequence ENSEMBL: ENSMUSP00000139699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
Predicted Effect probably benign
Transcript: ENSMUST00000020158
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186446
Predicted Effect probably benign
Transcript: ENSMUST00000188495
AA Change: S403P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: S403P

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216985
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik G A 7: 126,830,893 P69S probably damaging Het
Abca15 A G 7: 120,373,794 R864G probably benign Het
Acbd5 T C 2: 23,069,478 C15R possibly damaging Het
Ahctf1 A T 1: 179,777,390 probably null Het
Ak3 T A 19: 29,022,940 K190N probably damaging Het
B4galnt3 A T 6: 120,206,614 probably null Het
Calcrl T C 2: 84,333,530 H439R probably benign Het
Casp7 T A 19: 56,441,020 D279E possibly damaging Het
Cckar A G 5: 53,699,844 V337A probably benign Het
Cep85l T C 10: 53,281,555 Y684C probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Homo
Commd7 T C 2: 153,632,610 N23S possibly damaging Het
Cpne9 A T 6: 113,294,773 I365F possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dot1l C T 10: 80,786,443 A831V probably benign Het
Epcam C A 17: 87,640,436 N111K probably damaging Het
Etnk1 A G 6: 143,180,798 Q123R probably damaging Het
Fam170a A T 18: 50,281,950 E221V probably damaging Het
Fam189a2 T C 19: 23,973,438 E593G probably damaging Het
Fbl T C 7: 28,174,853 S88P possibly damaging Het
Fbxo36 T A 1: 84,896,530 Y82* probably null Het
Fer1l5 A G 1: 36,385,160 K285R probably damaging Het
Foxn3 G T 12: 99,196,310 T444K probably damaging Het
Gak C T 5: 108,625,029 probably null Het
Gprc6a T C 10: 51,626,835 I311V probably benign Het
Hrg T C 16: 22,954,538 probably null Het
Htatip2 G A 7: 49,770,819 V138I probably benign Het
Ighv1-4 A T 12: 114,487,522 probably benign Het
Kcnq2 T C 2: 181,113,233 M174V possibly damaging Het
Krt39 G T 11: 99,521,215 P15Q probably damaging Het
L1td1 G A 4: 98,737,418 D617N possibly damaging Het
Lgalsl T A 11: 20,829,382 K88* probably null Het
Lims1 A T 10: 58,394,564 K49M possibly damaging Het
Man2a1 T C 17: 64,713,605 V792A probably benign Het
Mcm2 G T 6: 88,885,862 D749E probably benign Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Nek6 T C 2: 38,557,834 S37P possibly damaging Het
Olfr149 T C 9: 39,702,310 H153R probably benign Het
Olfr310 A C 7: 86,269,760 F10V probably damaging Het
Olfr622 A G 7: 103,640,002 V46A probably benign Het
Olfr663 G A 7: 104,703,611 V15M probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Prune2 T A 19: 17,118,116 I328N probably damaging Het
Psap T A 10: 60,300,538 C484S probably damaging Het
Pus1 T C 5: 110,777,714 D80G probably benign Het
Rasa3 T C 8: 13,598,251 T138A possibly damaging Het
Scaf1 G T 7: 45,007,623 probably benign Het
Skap1 T A 11: 96,704,133 Y143* probably null Het
Slc22a20 A G 19: 5,985,941 L67P probably damaging Het
Slc25a17 T C 15: 81,329,064 Y146C probably damaging Het
Slfn4 C T 11: 83,189,125 T154I possibly damaging Het
Snai1 T A 2: 167,538,309 V7D probably damaging Het
Snrnp200 T A 2: 127,210,735 M84K probably benign Het
Spop G T 11: 95,471,237 K31N possibly damaging Het
Surf1 T C 2: 26,914,807 T145A probably benign Het
Tbkbp1 T C 11: 97,146,339 E278G probably damaging Het
Thumpd2 G A 17: 81,055,837 A67V probably damaging Het
Timd4 A T 11: 46,815,526 M52L probably damaging Het
Trav16 A T 14: 53,743,588 N78I probably damaging Het
Tspan12 T C 6: 21,799,908 T147A probably damaging Het
Tulp1 A T 17: 28,358,677 probably benign Het
Ubqlnl A T 7: 104,148,708 N527K possibly damaging Het
Ubr4 G A 4: 139,421,248 C1681Y probably damaging Het
Unc13c T C 9: 73,758,628 K1037E possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r4 G A 3: 64,406,505 H352Y probably damaging Het
Vmn2r61 A T 7: 42,260,192 H47L probably benign Het
Vwa5a A G 9: 38,722,672 E57G probably damaging Het
Zfp180 A T 7: 24,105,085 R310* probably null Het
Zfp672 T C 11: 58,317,523 probably benign Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0882:Myb UTSW 10 21156360 missense possibly damaging 0.75
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1879:Myb UTSW 10 21141977 missense probably benign 0.24
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5121:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6150:Myb UTSW 10 21141769 missense probably damaging 1.00
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6824:Myb UTSW 10 21145120 missense probably benign 0.00
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
R7562:Myb UTSW 10 21141754 splice site probably null
R7651:Myb UTSW 10 21156374 missense probably damaging 1.00
R7747:Myb UTSW 10 21156425 missense possibly damaging 0.89
R8346:Myb UTSW 10 21126237 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAGTTGAGCTGATGACGTC -3'
(R):5'- ATGTGCAAGACAACCCATGC -3'

Sequencing Primer
(F):5'- AGCGGAACCTTGCTGTG -3'
(R):5'- ATGCACCGCTGTAATCCCTGAG -3'
Posted On2018-02-27