Incidental Mutation 'R6208:Actl6a'
ID503246
Institutional Source Beutler Lab
Gene Symbol Actl6a
Ensembl Gene ENSMUSG00000027671
Gene Nameactin-like 6A
Synonyms2810432C06Rik, Baf53a, ARP4, Actl6
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32706298-32726973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32711894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 18 (I18F)
Ref Sequence ENSEMBL: ENSMUSP00000141354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000126144] [ENSMUST00000193615] [ENSMUST00000194781]
Predicted Effect probably benign
Transcript: ENSMUST00000029214
AA Change: I18F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671
AA Change: I18F

DomainStartEndE-ValueType
ACTIN 11 429 1.37e-189 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126144
SMART Domains Protein: ENSMUSP00000114317
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
ACTIN 1 204 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135400
Predicted Effect probably benign
Transcript: ENSMUST00000193231
Predicted Effect probably benign
Transcript: ENSMUST00000193615
AA Change: I18F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141354
Gene: ENSMUSG00000027671
AA Change: I18F

DomainStartEndE-ValueType
Pfam:Actin 8 60 1.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194226
Predicted Effect probably benign
Transcript: ENSMUST00000194781
AA Change: I22F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141543
Gene: ENSMUSG00000027671
AA Change: I22F

DomainStartEndE-ValueType
ACTIN 15 245 1.5e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E6.5. Mice homozygous for a conditional allele activated in hematopoietic cells exhibit bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Actl6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Actl6a APN 3 32712164 missense probably benign 0.01
IGL01691:Actl6a APN 3 32720200 missense possibly damaging 0.94
IGL02902:Actl6a APN 3 32722642 missense possibly damaging 0.93
R0194:Actl6a UTSW 3 32725320 missense probably damaging 1.00
R1193:Actl6a UTSW 3 32712144 missense probably benign 0.00
R1404:Actl6a UTSW 3 32722610 unclassified probably benign
R1754:Actl6a UTSW 3 32718574 missense probably damaging 1.00
R4289:Actl6a UTSW 3 32712114 missense possibly damaging 0.87
R5020:Actl6a UTSW 3 32720507 missense possibly damaging 0.79
R5165:Actl6a UTSW 3 32720208 missense probably benign 0.01
R5272:Actl6a UTSW 3 32718610 missense probably damaging 0.97
R5384:Actl6a UTSW 3 32720493 missense probably damaging 1.00
R5640:Actl6a UTSW 3 32718050 missense probably damaging 0.99
R5722:Actl6a UTSW 3 32718045 missense probably damaging 0.97
R5865:Actl6a UTSW 3 32712128 missense possibly damaging 0.80
R7094:Actl6a UTSW 3 32706338 start gained probably benign
R7192:Actl6a UTSW 3 32720224 missense probably damaging 1.00
R7866:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
R8734:Actl6a UTSW 3 32719955 missense probably benign 0.06
Z1176:Actl6a UTSW 3 32726543 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGTGTACCATGGCTTTCCTG -3'
(R):5'- ACCTGGGACGTTAAAATATGGC -3'

Sequencing Primer
(F):5'- TAATCCACTTGAGAGTCAGAGAC -3'
(R):5'- AAGGATCAGCTGCTCTCGG -3'
Posted On2018-02-27