Incidental Mutation 'R6208:Emc1'
ID 503255
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 044342-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R6208 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 139081582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 70 (R70L)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030513] [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000102503] [ENSMUST00000179784] [ENSMUST00000155257] [ENSMUST00000147999] [ENSMUST00000155700]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000030513
SMART Domains Protein: ENSMUSP00000030513
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 7.9e-23 PFAM
low complexity region 222 238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: R70L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R70L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: R70L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R70L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102503
SMART Domains Protein: ENSMUSP00000099561
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 18 121 4.6e-24 PFAM
low complexity region 223 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131052
Predicted Effect probably damaging
Transcript: ENSMUST00000179784
AA Change: R70L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R70L

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155257
SMART Domains Protein: ENSMUSP00000121453
Gene: ENSMUSG00000028741

DomainStartEndE-ValueType
Pfam:Ribosomal_L10 1 61 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139749
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144335
Meta Mutation Damage Score 0.5326 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,766,043 (GRCm39) I18F probably benign Het
Apol11a C T 15: 77,401,241 (GRCm39) R243C probably damaging Het
Asap3 A G 4: 135,968,508 (GRCm39) M687V probably benign Het
Axdnd1 C T 1: 156,220,426 (GRCm39) probably benign Het
Baz2b A G 2: 59,755,150 (GRCm39) F1026S probably damaging Het
Bsg T C 10: 79,544,672 (GRCm39) L70P probably damaging Het
Col10a1 A G 10: 34,270,582 (GRCm39) N185D possibly damaging Het
Col6a2 T A 10: 76,450,891 (GRCm39) N50I possibly damaging Het
Cux2 G A 5: 121,998,885 (GRCm39) P1352S possibly damaging Het
Defa25 A G 8: 21,575,197 (GRCm39) probably null Het
Fat1 T C 8: 45,480,650 (GRCm39) F3028S probably damaging Het
Fhit T C 14: 9,573,435 (GRCm38) E205G probably benign Het
Gaa C A 11: 119,171,997 (GRCm39) A700D probably benign Het
Gm20830 T G Y: 6,916,792 (GRCm39) E109A probably benign Homo
Grm1 A T 10: 10,595,690 (GRCm39) F646Y probably damaging Het
Hp1bp3 A G 4: 137,944,481 (GRCm39) probably benign Het
Lce1d G A 3: 92,593,312 (GRCm39) P34S unknown Het
Lpar1 G A 4: 58,504,630 (GRCm39) Q13* probably null Het
Lrrc61 C T 6: 48,545,839 (GRCm39) R221* probably null Het
Map2 A G 1: 66,470,749 (GRCm39) N328D probably damaging Het
Mndal T A 1: 173,684,988 (GRCm39) D527V possibly damaging Het
Mycbp2 T G 14: 103,532,664 (GRCm39) N430T probably benign Het
Myo1e A G 9: 70,283,887 (GRCm39) Y861C probably damaging Het
Nav2 A G 7: 49,213,851 (GRCm39) T1622A probably damaging Het
Nom1 A T 5: 29,654,617 (GRCm39) H773L possibly damaging Het
Npc2 G T 12: 84,803,919 (GRCm39) P144Q probably damaging Het
Npnt A G 3: 132,655,774 (GRCm39) probably benign Het
Nxpe4 A T 9: 48,304,678 (GRCm39) Y255F probably benign Het
Obscn G A 11: 58,958,474 (GRCm39) A3769V possibly damaging Het
Optc T C 1: 133,832,737 (GRCm39) D121G probably damaging Het
Pard6a T C 8: 106,428,866 (GRCm39) F26L probably damaging Het
Pcdhga4 T A 18: 37,819,762 (GRCm39) I437N probably damaging Het
Phf12 G T 11: 77,914,417 (GRCm39) V71F probably damaging Het
Phf21b T A 15: 84,679,317 (GRCm39) S282C probably damaging Het
Pou5f1 T C 17: 35,821,357 (GRCm39) F323S possibly damaging Het
Psmd5 A T 2: 34,757,023 (GRCm39) I67N probably damaging Het
Pyroxd1 A G 6: 142,303,182 (GRCm39) K273R probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpusd1 A T 17: 25,949,352 (GRCm39) H174L probably damaging Het
Ryr2 T C 13: 11,910,106 (GRCm39) K94R probably benign Het
Scn2b A G 9: 45,029,328 (GRCm39) R3G probably benign Het
Sf3b2 A T 19: 5,325,126 (GRCm39) M782K possibly damaging Het
Skint7 A G 4: 111,842,073 (GRCm39) probably null Het
Slc43a1 A G 2: 84,687,184 (GRCm39) I319V possibly damaging Het
Snupn T A 9: 56,890,247 (GRCm39) M356K probably damaging Het
Spata31d1a C A 13: 59,848,378 (GRCm39) R1250M probably damaging Het
Sprr2h T C 3: 92,294,216 (GRCm39) V21A unknown Het
Srpra A G 9: 35,127,291 (GRCm39) T614A possibly damaging Het
Stk36 A T 1: 74,650,591 (GRCm39) Q327L probably benign Het
Syne3 A G 12: 104,909,622 (GRCm39) I738T probably benign Het
Tcea3 A T 4: 135,975,360 (GRCm39) M1L probably damaging Het
Tead2 G T 7: 44,867,526 (GRCm39) R85L probably damaging Het
Thap7 T C 16: 17,346,300 (GRCm39) N228D possibly damaging Het
Trip11 T A 12: 101,865,154 (GRCm39) E173V probably damaging Het
Ttc38 T A 15: 85,725,698 (GRCm39) M187K possibly damaging Het
Vmn1r193 T A 13: 22,403,138 (GRCm39) T285S possibly damaging Het
Vmn2r106 T C 17: 20,488,591 (GRCm39) T603A probably damaging Het
Vps39 A T 2: 120,163,897 (GRCm39) M355K probably damaging Het
Wnt5b G T 6: 119,423,473 (GRCm39) L51I probably damaging Het
Xxylt1 A G 16: 30,826,626 (GRCm39) Y230H probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGAGCTCTTCATTAGCACGC -3'
(R):5'- GTGCTATCTTAAAGGCCTTCAGG -3'

Sequencing Primer
(F):5'- GAGCTCTTCATTAGCACGCACTTC -3'
(R):5'- CCTTCAGGACAGAGGGAAGGAATTAC -3'
Posted On 2018-02-27