Incidental Mutation 'R6208:Tead2'
ID503261
Institutional Source Beutler Lab
Gene Symbol Tead2
Ensembl Gene ENSMUSG00000030796
Gene NameTEA domain family member 2
SynonymsTEAD-2, TEF-4, Etdf
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45215753-45233644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45218102 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 85 (R85L)
Ref Sequence ENSEMBL: ENSMUSP00000147727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000097216] [ENSMUST00000107801] [ENSMUST00000209343] [ENSMUST00000209437] [ENSMUST00000209678] [ENSMUST00000210447] [ENSMUST00000211744]
Predicted Effect probably damaging
Transcript: ENSMUST00000033060
AA Change: R85L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796
AA Change: R85L

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000097216
AA Change: R50L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796
AA Change: R50L

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107801
AA Change: R85L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796
AA Change: R85L

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000209343
AA Change: R85L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209437
AA Change: R85L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000209678
AA Change: R17L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209818
Predicted Effect probably benign
Transcript: ENSMUST00000210447
AA Change: R85L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211594
Predicted Effect probably damaging
Transcript: ENSMUST00000211744
AA Change: R85L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211778
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a functionally null allele of this gene exhibit no gross abnormalities and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Tead2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Tead2 APN 7 45217251 missense probably damaging 0.96
IGL01887:Tead2 APN 7 45232310 missense probably damaging 1.00
IGL02378:Tead2 APN 7 45218147 critical splice donor site probably null
IGL02441:Tead2 APN 7 45217421 missense probably damaging 1.00
IGL02716:Tead2 APN 7 45232296 nonsense probably null
IGL02939:Tead2 APN 7 45220434 splice site probably benign
IGL03302:Tead2 APN 7 45232899 missense possibly damaging 0.86
R0325:Tead2 UTSW 7 45225755 missense probably damaging 1.00
R0611:Tead2 UTSW 7 45217250 missense probably damaging 0.99
R2571:Tead2 UTSW 7 45225770 missense probably damaging 1.00
R3401:Tead2 UTSW 7 45223673 unclassified probably benign
R3847:Tead2 UTSW 7 45232328 splice site probably null
R3849:Tead2 UTSW 7 45232328 splice site probably null
R3850:Tead2 UTSW 7 45232328 splice site probably null
R5729:Tead2 UTSW 7 45220742 unclassified probably benign
R5932:Tead2 UTSW 7 45232899 missense probably benign 0.00
R5956:Tead2 UTSW 7 45220714 unclassified probably benign
R6729:Tead2 UTSW 7 45217234 missense probably benign
R7152:Tead2 UTSW 7 45220447 missense possibly damaging 0.46
R8120:Tead2 UTSW 7 45216328 intron probably benign
R8272:Tead2 UTSW 7 45228742 missense probably benign 0.00
R8379:Tead2 UTSW 7 45218081 missense probably damaging 1.00
Z1176:Tead2 UTSW 7 45217238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCAAGTGTCCAGAGTCTG -3'
(R):5'- GGGGCCTCCTACACTCACATATAC -3'

Sequencing Primer
(F):5'- TCAAAGCCAGTGTGGTCTAC -3'
(R):5'- CATACGAACCACATCATCAGCCTTG -3'
Posted On2018-02-27